Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMD4-proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 Gene
PTXBC002365
New product
Data sheet of PSMD4-proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMD4-proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002365 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMD4 |
| Origin species: | Human |
| Product name: | PSMD4-proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 Gene |
| Size: | 2ug |
| Accessions: | BC002365 |
| Gene id: | 5710 |
| Gene description: | proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |
| Synonyms: | AF-1; ASF; MCB1; Rpn10; S5A; pUB-R5; 26S proteasome non-ATPase regulatory subunit 4; 26S proteasome regulatory subunit S5A; S5a/antisecretory factor protein; angiocidin; antisecretory factor 1; multiubiquitin chain-binding protein; proteasome (prosome, macropain) 26S subunit, non-ATPase, 4; proteasome 26S subunit, non-ATPase 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgttggaaagcactatggtgtgtgtggacaacagtgagtatatgcggaatggagacttcttacccaccaggctgcaggcccagcaggatgctgtcaacatagtttgtcattcaaagacccgcagcaaccctgagaacaacgtgggccttatcacactggctaatgactgtgaagtgctgaccacactcaccccagacactggccgtatcctgtccaagctacatactgtccaacccaagggcaagatcaccttctgcacgggcatccgcgtggcccatctggctctgaagcaccgacaaggcaagaatcacaagatgcgcatcattgcctttgtgggaagcccagtggaggacaatgagaaggatctggtgaaactggctaaacgcctcaagaaggagaaagtaaatgttgacattatcaattttggggaagaggaggtgaacacagaaaagctgacagcctttgtaaacacgttgaatggcaaagatggaaccggttctcatctggtgacagtgcctcctgggcccagtttggctgatgctctcatcagttctccgattttggctggtgaaggtggtgccatgctgggtcttggtgccagtgactttgaatttggagtagatcccagtgctgatcctgagctggccttggcccttcgtgtatctatggaagagcagcggcagcggcaggaggaggaggcccggcgggcagctgcagcttctgctgctgaggccgggattgctacgactgggactgaagactcagacgatgccctgctgaagatgaccatcagccagcaagagtttggccgcactgggcttcctgacctaagcagtatgactgaggaagagcagattgcttatgccatgcagatgtccctgcagggagcagagtttggccaggcggaatcagcagacattgatgccagctcagctatggacacatctgagccagccaaggaggaggatgattacgacgtgatgcaggaccccgagttccttcagagtgtcctagagaacctcccaggtgtggatcccaacaatgaagccattcgaaatgctatgggctccctggcctcccaggccaccaaggacggcaagaaggacaagaaggaggaagacaagaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 - solute carrier family 18 (vesicular monoamine), member 1 - pleckstrin homology domain containing, family O member 1 - solute carrier family 18 (vesicular monoamine), member 1 |