Login to display prices
Login to display prices
ATP6V1C1-ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 Gene View larger

ATP6V1C1-ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 Gene

PTXBC010960

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP6V1C1-ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP6V1C1-ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 Gene

Proteogenix catalog: PTXBC010960
Ncbi symbol: ATP6V1C1
Product name: ATP6V1C1-ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 Gene
Size: 2ug
Accessions: BC010960
Gene id: 528
Gene description: ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
Synonyms: ATP6C; ATP6D; VATC; Vma5; V-type proton ATPase subunit C 1; ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1; H(+)-transporting two-sector ATPase, subunit C; H+ -ATPase C subunit; H+-transporting ATPase chain C, vacuolar; V-ATPase C subunit; V-ATPase subunit C 1; subunit C of vacuolar proton-ATPase V1 domain; testicular tissue protein Li 223; vacuolar ATP synthase subunit C; vacuolar proton pump C subunit; vacuolar proton pump subunit C 1; vacuolar proton pump, 42-kD subunit; vacuolar proton-ATPase, subunit C, VI domain; ATPase H+ transporting V1 subunit C1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgagttctggcttatatctgctcctggggagaaaacctgtcagcaaacatgggagaaattgcatgcggcaacttcaaagaacaataatcttgctgtcacttccaagttcaatattcctgacttaaaggttggcacgttggatgtcttggttggcttgtcagatgaactggctaaactggatgcatttgtagaaggagtggttaagaaagtagctcaatacatggctgatgtattggaagatagcaaagacaaagttcaagagaatctgttggctaatggagtggacttggttacttatataacaaggttccagtgggacatggccaaatatccaatcaagcagtccctgaaaaatatttctgaaataattgccaagggagtaactcagattgataatgacctgaaatctcgagcatctgcatacaataacctgaaaggaaatcttcagaatttggaacgaaagaatgcaggaagtttgctaactagaagtctagcagaaattgtgaagaaggatgactttgttcttgattcagagtatctcgtcacattactggtagtagttcccaagttaaaccacaacgactggattaagcagtatgaaacactagccgaaatggtagttccaaggtctagcaatgttctttcagaggaccaagacagttacctgtgtaatgtcaccttgtttaggaaggcagttgatgacttcagacacaaagccagagaaaacaaattcattgttcgtgacttccagtataatgaagaggagatgaaagcagataaagaagaaatgaacaggctttctactgataagaaaaaacaatttggaccacttgtacggtggctgaaagtgaattttagtgaagcatttattgcatggattcacgtgaaagcattacgggttttcgttgagtctgttttaaggtatggcttgccagtgaacttccaagcaatgctacttcagcccaataagaaaactttgaagaaactgagagaagtattacatgaattgtataaacatctagacagcagtgcagcagctattattgatgctcctatggatattccaggtttaaacctgagtcaacaagaatactacccctatgtgtactacaagattgattgcaacttgctggaattcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: