POLR3F-polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa Gene View larger

POLR3F-polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa Gene

PTXBC012588

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLR3F-polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POLR3F-polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012588
Product type: DNA & cDNA
Ncbi symbol: POLR3F
Origin species: Human
Product name: POLR3F-polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa Gene
Size: 2ug
Accessions: BC012588
Gene id: 10621
Gene description: polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa
Synonyms: RPC39; RPC6; DNA-directed RNA polymerase III subunit RPC6; RNA polymerase III C39 subunit; RNA polymerase III subunit C6; polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa; polymerase (RNA) III subunit F; RNA polymerase III subunit F
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggaggtgaaggtgaaggtgcagccgcctgacgcggatccggtcgaaatagaaaacaggattatagaattatgtcaccagttccctcatggaatcacagaccaagtaattcagaatgaaatgcctcatatagaagcccagcagcgggcagtagccatcaataggttgttgtctatgggtcagttggatctcttaaggagcaatacgggccttttatatagaataaaggactctcagaatgctggtaaaatgaagggatccgataaccaagaaaaactagtatatcaaatcatagaggatgcaggaaataaaggaatatggagcagagatatccgctataaaagtaatttgccattaacagaaatcaacaaaattctgaagaatctggaaagtaaaaagcttatcaaagctgttaagtctgtagcagcctcaaaaaagaaggtgtatatgctctataacctgcagccagaccggtctgtgactggtggagcctggtacagtgaccaggattttgaatctgaatttgtagaggtgcttaaccaacagtgttttaaattcctacagtccaaggcagaaacagcacgagaaagcaaacagaacccaatgatacaaagaaatagttcatttgcctcatcacatgaagtgtggaaatatatctgcgaattgggaatcagtaaggtagagttatccatggaagacattgaaaccatcctgaatacactcatttatgatggaaaagtggagatgacgattattgctgcaaaagaaggcacagttggcagtgtagatggacacatgaaactgtacagggcagtcaatccaatcatccctcccacgggtttggtccgggcaccctgtggactctgcccggtttttgatgactgccacgaaggtggtgagatttcaccatctaactgtatttacatgacagagtggctcgaattttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein phosphatase 1, regulatory (inhibitor) subunit 3C
- 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1
- par-6 partitioning defective 6 homolog alpha (C. elegans)
- SAM domain, SH3 domain and nuclear localization signals 1

Buy POLR3F-polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa Gene now

Add to cart