PPP1R3C-protein phosphatase 1, regulatory (inhibitor) subunit 3C Gene View larger

PPP1R3C-protein phosphatase 1, regulatory (inhibitor) subunit 3C Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP1R3C-protein phosphatase 1, regulatory (inhibitor) subunit 3C Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPP1R3C-protein phosphatase 1, regulatory (inhibitor) subunit 3C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012625
Product type: DNA & cDNA
Ncbi symbol: PPP1R3C
Origin species: Human
Product name: PPP1R3C-protein phosphatase 1, regulatory (inhibitor) subunit 3C Gene
Size: 2ug
Accessions: BC012625
Gene id: 5507
Gene description: protein phosphatase 1, regulatory (inhibitor) subunit 3C
Synonyms: PPP1R5; PTG; protein phosphatase 1 regulatory subunit 3C; PP1 subunit R5; Phosphatase 1, regulatory inhibitor subunit 5; protein phosphatase 1 regulatory subunit 5; protein phosphatase 1, regulatory (inhibitor) subunit 3C; protein targeting to glycogen
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctgcaccagaatgatccaggttttagatccacgtcctttgacaagttcggtcatgcccgtggatgtggccatgaggctttgcttggcacattcaccacctgtgaagagtttcctgggcccgtacgatgaatttcaacgacgacattttgtgaataaattaaagcccctgaaatcatgtctcaatataaaacacaaagccaaatcacagaatgactggaagtgctcacacaaccaagccaagaagcgcgttgtgtttgctgactccaagggcctctctctcactgcgatccatgtcttctccgacctcccagaagaaccagcgtgggatctgcagtttgatctcttggaccttaatgatatctcctctgccttaaaacaccacgaggagaaaaacttgattttagatttccctcagccttcaaccgattacttaagtttccggagccactttcagaagaactttgtctgtctggagaactgctcattgcaagagcgaacagtgacagggactgttaaagtcaaaaatgtgagttttgagaagaaagttcagatccgtatcactttcgattcttggaaaaactacactgacgtagactgtgtctatatgaaaaatgtgtatggtggcacagatagtgataccttctcatttgccattgacttaccccctgtcattccaactgagcagaaaattgagttctgcatttcttaccatgctaatgggcaagtcttttgggacaacaatgatggtcagaattatagaattgttcatgttcaatggaagcctgatggggtgcagacacagatggcaccccaggactgtgcattccaccagacgtctcctaagacagagttagagtcaacaatctttggcagtccgaggctggctagtgggctcttcccagagtggcagagctgggggagaatggagaacttggcctcttatcgatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1
- par-6 partitioning defective 6 homolog alpha (C. elegans)
- SAM domain, SH3 domain and nuclear localization signals 1
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

Buy PPP1R3C-protein phosphatase 1, regulatory (inhibitor) subunit 3C Gene now

Add to cart