Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP1R3C-protein phosphatase 1, regulatory (inhibitor) subunit 3C Gene
PTXBC012625
New product
Data sheet of PPP1R3C-protein phosphatase 1, regulatory (inhibitor) subunit 3C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP1R3C-protein phosphatase 1, regulatory (inhibitor) subunit 3C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012625 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP1R3C |
| Origin species: | Human |
| Product name: | PPP1R3C-protein phosphatase 1, regulatory (inhibitor) subunit 3C Gene |
| Size: | 2ug |
| Accessions: | BC012625 |
| Gene id: | 5507 |
| Gene description: | protein phosphatase 1, regulatory (inhibitor) subunit 3C |
| Synonyms: | PPP1R5; PTG; protein phosphatase 1 regulatory subunit 3C; PP1 subunit R5; Phosphatase 1, regulatory inhibitor subunit 5; protein phosphatase 1 regulatory subunit 5; protein phosphatase 1, regulatory (inhibitor) subunit 3C; protein targeting to glycogen |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagctgcaccagaatgatccaggttttagatccacgtcctttgacaagttcggtcatgcccgtggatgtggccatgaggctttgcttggcacattcaccacctgtgaagagtttcctgggcccgtacgatgaatttcaacgacgacattttgtgaataaattaaagcccctgaaatcatgtctcaatataaaacacaaagccaaatcacagaatgactggaagtgctcacacaaccaagccaagaagcgcgttgtgtttgctgactccaagggcctctctctcactgcgatccatgtcttctccgacctcccagaagaaccagcgtgggatctgcagtttgatctcttggaccttaatgatatctcctctgccttaaaacaccacgaggagaaaaacttgattttagatttccctcagccttcaaccgattacttaagtttccggagccactttcagaagaactttgtctgtctggagaactgctcattgcaagagcgaacagtgacagggactgttaaagtcaaaaatgtgagttttgagaagaaagttcagatccgtatcactttcgattcttggaaaaactacactgacgtagactgtgtctatatgaaaaatgtgtatggtggcacagatagtgataccttctcatttgccattgacttaccccctgtcattccaactgagcagaaaattgagttctgcatttcttaccatgctaatgggcaagtcttttgggacaacaatgatggtcagaattatagaattgttcatgttcaatggaagcctgatggggtgcagacacagatggcaccccaggactgtgcattccaccagacgtctcctaagacagagttagagtcaacaatctttggcagtccgaggctggctagtgggctcttcccagagtggcagagctgggggagaatggagaacttggcctcttatcgatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 - par-6 partitioning defective 6 homolog alpha (C. elegans) - SAM domain, SH3 domain and nuclear localization signals 1 - proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 |