Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMD8-proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 Gene
PTXBC001164
New product
Data sheet of PSMD8-proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMD8-proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001164 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMD8 |
| Origin species: | Human |
| Product name: | PSMD8-proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 Gene |
| Size: | 2ug |
| Accessions: | BC001164 |
| Gene id: | 5714 |
| Gene description: | proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 |
| Synonyms: | HEL-S-91n; HIP6; HYPF; Nin1p; Rpn12; S14; p31; 26S proteasome non-ATPase regulatory subunit 8; 26S proteasome regulatory subunit RPN12; 26S proteasome regulatory subunit S14; 26S proteasome regulatory subunit p31; epididymis secretory sperm binding protein Li 91n; proteasome (prosome, macropain) 26S subunit, non-ATPase, 8; proteasome 26S subunit, non-ATPase 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtacgagcaactcaagggcgagtggaaccgtaaaagccccaatcttagcaagtgcggggaagagctgggtcgactcaagctagttcttctggagctcaacttcttgccaaccacagggaccaagctgaccaaacagcagctaattctggcccgtgacatactggagatcggggcccaatggagcatcctacgcaaggacatcccctccttcgagcgctacatggcccagctcaaatgctactactttgattacaaggagcagctccccgagtcagcctatatgcaccagctcttgggcctcaacctcctcttcctgctgtcccagaaccgggtggctgagttccacacggagttggagcggctgcctgccaaggacatacagaccaatgtctacatcaagcacccagtgtccctggagcaatacctgatggagggcagctacaacaaagtgttcctggccaagggtaacatccccgccgagagctacaccttcttcattgacatcctgctcgacactatcagggatgagatcgctgggtgcatcgagaaggcctacgagaaaatccttttcactgaggccacccggatcctcttcttcaacacacccaaaaagatgacagactacgccaagaagcgagggtgggtcctgggccccaacaactactacagttttgccagccagcagcagaagccggaagacaccaccattccctccacagaactggccaaacaggtcatcgagtatgcccggcagctggagatgatcgtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) - polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa - protein phosphatase 1, regulatory (inhibitor) subunit 3C - 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 |