TSPAN1-tetraspanin 1 Gene View larger

TSPAN1-tetraspanin 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSPAN1-tetraspanin 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TSPAN1-tetraspanin 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007290
Product type: DNA & cDNA
Ncbi symbol: TSPAN1
Origin species: Human
Product name: TSPAN1-tetraspanin 1 Gene
Size: 2ug
Accessions: BC007290
Gene id: 10103
Gene description: tetraspanin 1
Synonyms: NET1; TM4C; TM4SF; tetraspanin-1; tetraspan 1; tetraspanin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagtgcttcagcttcattaagaccatgatgatcctcttcaatttgctcatctttctgtgtggtgcagccctgttggcagtgggcatctgggtgtcaatcgatggggcatcctttctgaagatcttcgggccactgtcgtccagtgccatgcagtttgtcaacgtgggctacttcctcatcgcagccggcgttgtggtctttgctcttggtttcctgggctgctatggtgctaagactgagagcaagtgtgccctcgtgacgttcttcttcatcctcctcctcatcttcattgctgaggttgcagctgctgtggtcgccttggtgtacaccacaatggctgagcacttcctgacgttgctggtagtgcctgccatcaagaaagattatggttcccaggaagacttcactcaagtgtggaacaccaccatgaaagggctcaagtgctgtggcttcaccaactatacggattttgaggactcaccctacttcaaagagaacagtgcctttcccccattctgttgcaatgacaacgtcaccaacacagccaatgaaacctgcaccaagcaaaaggctcacgaccaaaaagtagagggttgcttcaatcagcttttgtatgacatccgaactaatgcagtcaccgtgggtggtgtggcagctggaattgggggcctcgagctggctgccatgattgtgtccatgtatctgtactgcaatctacaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Src-like-adaptor
- actin, gamma 1
- sorting nexin 4
- sorting nexin 9

Buy TSPAN1-tetraspanin 1 Gene now

Add to cart