SLA-Src-like-adaptor Gene View larger

SLA-Src-like-adaptor Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLA-Src-like-adaptor Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLA-Src-like-adaptor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007042
Product type: DNA & cDNA
Ncbi symbol: SLA
Origin species: Human
Product name: SLA-Src-like-adaptor Gene
Size: 2ug
Accessions: BC007042
Gene id: 6503
Gene description: Src-like-adaptor
Synonyms: SLA1; SLAP; src-like-adapter; SLAP-1; hSLAP; src-like-adapter protein 1; Src-like-adaptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaaacagcatgaaatccacccctgcgcctgccgagaggcccctgcccaacccggagggactggatagcgacttccttgccgtgctaagtgactacccgtctcctgacatcagccccccgatattccgccgaggggagaaactgcgtgtgatttctgatgaagggggctggtggaaagctatttctcttagcactggtcgagagagttacatccctggaatatgtgtggccagagtttaccatggctggctgtttgagggcctgggcagagacaaggccgaggagctgctgcagctgccagacacaaaggtcggctcctttatgatcagagagagtgagaccaagaaagggttttactcactgtcggtgagacacaggcaggtaaagcattaccgcattttccgtctgcccaacaactggtactacatttccccgaggctcaccttccagtgcctggaggacctggtgaaccactattctgaggtggctgatggcctgtgctgtgtgctcaccacgccctgcctgacacaaagcacggctgccccagcagtgagggcctccagctcacctgtcaccttgcgtcagaagactgtggactggaggagagtgtccagactgcaggaggaccccgagggaacagagaacccgcttggggtagacgagtcccttttcagctatggccttcgagagagcattgcctcttacctgtccctgaccagtgaggacaacacctcctttgatcgaaagaagaaaagcatctccctgatgtatggtggcagcaagagaaagagctcattcttctcatcaccaccttactttgaggactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - actin, gamma 1
- sorting nexin 4
- sorting nexin 9
- ATM interactor

Buy SLA-Src-like-adaptor Gene now

Add to cart