RTDR1-rhabdoid tumor deletion region gene 1 Gene View larger

RTDR1-rhabdoid tumor deletion region gene 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RTDR1-rhabdoid tumor deletion region gene 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RTDR1-rhabdoid tumor deletion region gene 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008986
Product type: DNA & cDNA
Ncbi symbol: RTDR1
Origin species: Human
Product name: RTDR1-rhabdoid tumor deletion region gene 1 Gene
Size: 2ug
Accessions: BC008986
Gene id: 27156
Gene description: rhabdoid tumor deletion region gene 1
Synonyms: RTDR1; radial spoke head 14 homolog; rhabdoid tumor deletion region gene 1; rhabdoid tumor deletion region protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccattcccagaactccttggagcttcccattaacatcaatgccacccagattaccactgcctatggccatcgggccctgcccaagctgaaggaggagctgcagtcagaggacctccagacgaggcagaaagccctcatggccctgtgtgacctcatgcatgaccccgagtgtatctacaaggccatgaacataggctgtatggagaacctgaaagctttgctgaaggatagcaacagtatggtgcgcataaagaccaccgaggtgctccacatcacggcaagccatagcgtgggcagatacgcctttctagagcacgacatcgtccttgccctgtccttcctgctgaatgaccccagcccagtctgccgggggaacctgtacaaggcatacatgcagctggtccaggtgcctagaggggcccaagagatcatcagcaaaggtctgatttcctcactggtatggaagctgcaggtggaggtggaggaggaggagttccaggagttcatcctggacacactggtcctctgcctgcaggaggatgccaccgaggccctgggcagcaatgtggtgcttgtcctgaagcagaagctcctcagcgccaaccagaacatccgcagcaaggccgcccgtgcgctccttaatgtcagcatatctcgagagggcaagaaacaggtgtgtcattttgacgtcatccccatcctggtccatctgctgaaagacccagtggagcatgtgaagtctaacgctgccggtgccctgatgttcgccacagtgatcactgaagggaagtatgcggccctggaggcacaagccatcggcctgctcctggagctgctgcactcccccatgaccatagcgcgcctgaatgccaccaaggcccttaccatgctggcagaggcccccgagggccgcaaggccctgcagacgcacgtgcccactttccgtgccatggaggtggagacttacgaaaagcctcaagtggccgaagccttacagcgggcagcccggatcgccatcagtgtcatcgagttcaaaccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - single-stranded DNA binding protein 2
- solute carrier family 35, member C1
- nucleosome assembly protein 1-like 4
- flap structure-specific endonuclease 1

Buy RTDR1-rhabdoid tumor deletion region gene 1 Gene now

Add to cart