SSBP2-single-stranded DNA binding protein 2 Gene View larger

SSBP2-single-stranded DNA binding protein 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SSBP2-single-stranded DNA binding protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SSBP2-single-stranded DNA binding protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017020
Product type: DNA & cDNA
Ncbi symbol: SSBP2
Origin species: Human
Product name: SSBP2-single-stranded DNA binding protein 2 Gene
Size: 2ug
Accessions: BC017020
Gene id: 23635
Gene description: single-stranded DNA binding protein 2
Synonyms: HSPC116; SOSS-B2; single-stranded DNA-binding protein 2; sequence-specific single-stranded-DNA-binding protein 2; single stranded DNA binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtacggcaaaggcaagagtaacagcagcgccgtcccgtccgacagccaggcccgggagaagttagcactctacgtatatgaatatctgctccatgtaggagctcagaaatcagctcaaacatttttatcagagataagatgggaaaaaaacatcacattgggggaaccaccaggattcttacattcttggtggtgtgtattttgggatctctactgtgcagctccagagagacgtgaaacatgtgaacactcaagtgaagcaaaagccttccatgattacagtgctgcagcagctcccagtccagtgctaggaaacattcccccaggagatggcatgccagtaggtcctgtaccaccagggttctttcagccttttatgtcacctcggtaccctggaggtccaaggcccccattgaggatacctaatcaggcacttggaggtgtcccaggaagtcagccattactccccagtggaatggatccaactcgacaacaaggacatccaaatatgggtgggccaatgcagagaatgactcctccaagaggaatggtgcccttaggaccacagaactatggaggtgcaatgagacccccactgaatgctttaggtggccctggaatgcctggaatgaacatgggtccaggtggtggtagaccttggccaaacccaacaaatgccaattcaataccatactcctcagcatctcctgggaattatgtaggtcctccaggaggtggagggccaccaggaacacccatcatgcctagtccagcagattcaaccaactctggtgataacatgtatactttaatgaatgcagtacctcctggacctaacagacctaattttccaatgggtcctgggtcagatggtcccatgggtggattaggaggaatggagtcacatcacatgaatggctctttaggctcaggagatatggacagtatttccaagaattctcccaataatatgagcctgagtaatcaaccgggcactccaagggatgatggcgaaatggggggaaatttcttaaatccttttcagagtgagagttactcccctagcatgacaatgagcgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 35, member C1
- nucleosome assembly protein 1-like 4
- flap structure-specific endonuclease 1
- cysteine-rich, angiogenic inducer, 61

Buy SSBP2-single-stranded DNA binding protein 2 Gene now

Add to cart