CYR61-cysteine-rich, angiogenic inducer, 61 Gene View larger

CYR61-cysteine-rich, angiogenic inducer, 61 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYR61-cysteine-rich, angiogenic inducer, 61 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CYR61-cysteine-rich, angiogenic inducer, 61 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001271
Product type: DNA & cDNA
Ncbi symbol: CYR61
Origin species: Human
Product name: CYR61-cysteine-rich, angiogenic inducer, 61 Gene
Size: 2ug
Accessions: BC001271
Gene id: 3491
Gene description: cysteine-rich, angiogenic inducer, 61
Synonyms: protein CYR61; CCN1; GIG1; IGFBP10; CCN family member 1; IBP-10; IGF-binding protein 10; IGFBP-10; cysteine-rich heparin-binding protein 61; cysteine-rich, anigogenic inducer, 61; insulin-like growth factor-binding protein 10; cysteine rich angiogenic inducer 61
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctcccgcatcgccagggcgctcgccttagtcgtcacccttctccacttgaccaggctggcgctctccacctgccccgctgcctgccactgccccctggaggcgcccaagtgcgcgccgggagtcgggctggtccgggacggctgcggctgctgtaaggtctgcgccaagcagctcaacgaggactgcagcaaaacgcagccctgcgaccacaccaaggggctggaatgcaacttcggcgccagctccaccgctctgaaggggatctgcagagctcagtcagagggcagaccctgtgaatataactccagaatctaccaaaacggggaaagtttccagcccaactgtaaacatcagtgcacatgtattgatggcgccgtgggctgcattcctctgtgtccccaagaactatctctccccaacttgggctgtcccaaccctcggctggtcaaagttaccgggcagtgctgcgaggagtgggtctgtgacgaggatagtatcaaggaccccatggaggaccaggacggcctccttggcaaggagctgggattcgatgcctccgaggtggagttgacgagaaacaatgaattgattgcagttggaaaaggcagctcactgaagcggctccctgtttttggaatggagcctcgcatcctatacaaccctttacaaggccagaaatgtattgttcaaacaacttcatggtcccagtgctcaaagacctgtggaactggtatctccacacgagttaccaatgacaaccctgagtgccgccttgtgaaagaaacccggatttgtgaggtgcggccttgtggacagccagtgtacagcagcctgaaaaagggcaagaaatgcagcaagaccaagaaatcccccgaaccagtcaggtttacttacgctggatgtttgagtgtgaagaaataccggcccaagtactgcggttcctgcgtggacggccgatgctgcacgccccagctgaccaggactgtgaagatgcggttccgctgcgaagatggggagacattttccaagaacgtcatgatgatccagtcctgcaaatgcaactacaactgcccgcatgccaatgaagcagcgtttcccttctacaggctgttcaatgacattcacaaatttagggactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - single stranded DNA binding protein 4
- breast carcinoma amplified sequence 3
- nucleosome assembly protein 1-like 1
- solute carrier family 35, member A5

Buy CYR61-cysteine-rich, angiogenic inducer, 61 Gene now

Add to cart