NAP1L4-nucleosome assembly protein 1-like 4 Gene View larger

NAP1L4-nucleosome assembly protein 1-like 4 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NAP1L4-nucleosome assembly protein 1-like 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NAP1L4-nucleosome assembly protein 1-like 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022090
Product type: DNA & cDNA
Ncbi symbol: NAP1L4
Origin species: Human
Product name: NAP1L4-nucleosome assembly protein 1-like 4 Gene
Size: 2ug
Accessions: BC022090
Gene id: 4676
Gene description: nucleosome assembly protein 1-like 4
Synonyms: NAP1L4b; NAP2; NAP2L; hNAP2; nucleosome assembly protein 1-like 4; NAP-2; nucleosome assembly protein 1-like 4b; nucleosome assembly protein 2; nucleosome assembly protein 1 like 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagatcacagtttttcagatggggttccttcagattccgtggaagctgctaaaaatgcaagtaacacagaaaagctcacagatcaggtgatgcagaatcctcgagttctggcagctttacaggagcgacttgacaatgtccctcacaccccttccagctacatcgaaactttacctaaagcagtaaaaagaagaattaatgcattgaaacaacttcaggtgagatgtgctcacatagaagccaagttctatgaagaggtacatgacttggaaagaaagtatgcagcgctataccagcctctctttgacaagagaagagaatttatcaccggcgatgttgaaccaacagatgcggaatcggaatggcacagtgaaaatgaagaggaagagaaattggctggagacatgaaaagtaaagtagtcgtcacagaaaaagcagcggcaacggctgaagagccagatcccaaaggaattccagagttctggtttaccatcttcagaaatgtggacatgctgagtgaattagtccaggaatatgatgaaccaatcttgaaacacctgcaggatattaaagtgaaattttctgaccctggacagcctatgtcttttgtgttagagttccactttgaacccaacgactactttaccaactcagtcctgacaaaaacctacaagatgaaatcagaaccagataaggctgatcccttttcctttgaaggtcctgagattgtggactgtgacgggtgtactattgactggaagaaaggaaagaatgttactgtcaaaaccatcaagaaaaagcagaagcataagggtcgaggcactgttagaacaattacgaaacaagtacccaatgagtcctttttcaacttcttcaatccattgaaagcatccggggatggagaatcactggatgaagattctgaattcacattagcctctgattttgaaattggacactttttccgtgagcggatagtcccgcgggctgtgctgtacttcactggggaggccatagaagatgatgacaattttgaagaaggtgaagaaggagaagaggaggaattagaaggtgacgaggagggagaagacgaggatgatgcggaaattaaccccaaggtgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - flap structure-specific endonuclease 1
- cysteine-rich, angiogenic inducer, 61
- single stranded DNA binding protein 4
- breast carcinoma amplified sequence 3

Buy NAP1L4-nucleosome assembly protein 1-like 4 Gene now

Add to cart