Login to display prices
Login to display prices
FEN1-flap structure-specific endonuclease 1 Gene View larger

FEN1-flap structure-specific endonuclease 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FEN1-flap structure-specific endonuclease 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FEN1-flap structure-specific endonuclease 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000323
Product type: DNA & cDNA
Ncbi symbol: FEN1
Origin species: Human
Product name: FEN1-flap structure-specific endonuclease 1 Gene
Size: 2ug
Accessions: BC000323
Gene id: 2237
Gene description: flap structure-specific endonuclease 1
Synonyms: FEN-1; MF1; RAD2; flap endonuclease 1; DNase IV; maturation factor-1; flap structure-specific endonuclease 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaattcaaggcctggccaaactaattgctgatgtggcccccagtgccatccgggagaatgacatcaagagctactttggccgtaaggtggccattgatgcctctatgagcatttatcagttcctgattgctgttcgccagggtggggatgtgctgcagaatgaggagggtgagaccaccagccacctgatgggcatgttctaccgcaccattcgcatgatggagaacggcatcaagcccgtgtatgtctttgatggcaagccgccacagctcaagtcaggcgagctggccaaacgcagtgagcggcgggctgaggcagagaagcagctgcagcaggctcaggctgctggggccgagcaggaggtggaaaaattcactaagcggctggtgaaggtcactaagcagcacaatgatgagtgcaaacatctgctgagcctcatgggcatcccttatcttgatgcacccagtgaggcagaggccagctgtgctgccctggtgaaggctggcaaagtctatgctgcggctaccgaggacatggactgcctcaccttcggcagccctgtgctaatgcgacacctgactgccagtgaagccaaaaagctgccaatccaggaattccacctgagccggattctgcaggagctgggcctgaaccaggaacagtttgtggatctgtgcatcctgctaggcagtgactactgtgagagtatccggggtattgggcccaagcgggctgtggacctcatccagaagcacaagagcatcgaggagatcgtgcggcgacttgaccccaacaagtaccctgtgccagaaaattggctccacaaggaggctcaccagctcttcttggaacctgaggtgctggacccagagtctgtggagctgaagtggagcgagccaaatgaagaagagctgatcaagttcatgtgtggtgaaaagcagttctctgaggagcgaatccgcagtggggtcaagaggctgagtaagagccgccaaggcagcacccagggccgcctggatgatttcttcaaggtgaccggctcactctcttcagctaagcgcaaggagccagaacccaagggatccactaagaagaaggcaaagactggggcagcagggaagtttaaaaggggaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cysteine-rich, angiogenic inducer, 61
- single stranded DNA binding protein 4
- breast carcinoma amplified sequence 3
- nucleosome assembly protein 1-like 1