Login to display prices
Login to display prices
SLC35C1-solute carrier family 35, member C1 Gene View larger

SLC35C1-solute carrier family 35, member C1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC35C1-solute carrier family 35, member C1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC35C1-solute carrier family 35, member C1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001427
Product type: DNA & cDNA
Ncbi symbol: SLC35C1
Origin species: Human
Product name: SLC35C1-solute carrier family 35, member C1 Gene
Size: 2ug
Accessions: BC001427
Gene id: 55343
Gene description: solute carrier family 35, member C1
Synonyms: CDG2C; FUCT1; GDP-fucose transporter 1; solute carrier family 35 (GDP-fucose transporter), member C1; solute carrier family 35 member C1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatagggcccctctgaagcggtccaggatcctgcacatggcgctgaccggggcctcagacccctctgcagaggcagaggccaacggggagaagccctttctgctgcgggcattgcagatcgcgctggtggtctccctctactcggtcacctccatctccatggtgttccttaataagtacctgctggacagcccctccctgcggctggacacccccatcttcgtcaccttctaccagtgcctggtgaccacgctgctgtgcaaaggcctcagcgctctggccgcctgctgccctggtgccgtggacttccccagcttgcgcctggacctcagggtggcccgcagcgtcctgcccctgtcggtggtcttcatcggcatgatcaccttcaataacctctgcctcaagtacgtcggtgtggccttctacaatgtgggccgctcactcaccaccgtcttcaacgtgctgctctcctacctgctgctcaagcagaccacctccttctatgccctgctcacctgcggtatcatcatcgggggcttctggcttggtgtggaccaggagggggcagaaggcaccctgtcgtggctgggcaccgtcttcggcgtgctggctagcctctgtgtctcgctcaacgccatctacaccacgaaggtgctcccggcggtggacggcagcatctggcgcctgactttctacaacaacgtcaacgcctgcatcctcttcctgcccctgctcctgctgctcggggagcttcaggccctgcgtgactttgcccagctgggcagtgcccacttctgggggatgatgacgctgggcggcctgtttggctttgccatcggctacgtgacaggactgcagatcaagttcaccagtccgctgacccacaatgtgtcgggcacggccaaggcctgtgcccagacagtgctggccgtgctctactacgaggagaccaagagcttcctctggtggacgagcaacatgatggtgctgggcggctcctccgcctacacctgggtcaggggctgggagatgaagaagactccggaggagcccagccccaaagacagcgagaagagcgccatgggggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nucleosome assembly protein 1-like 4
- flap structure-specific endonuclease 1
- cysteine-rich, angiogenic inducer, 61
- single stranded DNA binding protein 4