RBMS1-RNA binding motif, single stranded interacting protein 1 Gene View larger

RBMS1-RNA binding motif, single stranded interacting protein 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBMS1-RNA binding motif, single stranded interacting protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RBMS1-RNA binding motif, single stranded interacting protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018951
Product type: DNA & cDNA
Ncbi symbol: RBMS1
Origin species: Human
Product name: RBMS1-RNA binding motif, single stranded interacting protein 1 Gene
Size: 2ug
Accessions: BC018951
Gene id: 5937
Gene description: RNA binding motif, single stranded interacting protein 1
Synonyms: C2orf12; HCC-4; MSSP-1; MSSP-2; MSSP-3; SCR2; YC1; RNA-binding motif, single-stranded-interacting protein 1; c-myc gene single strand binding protein 2; cervical cancer oncogene 4; single-stranded DNA-binding protein MSSP-1; suppressor of CDC2 with RNA-binding motif 2; suppressor of cdc 2 (cdc13) with RNA binding motif 2; RNA binding motif single stranded interacting protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcaaagtgtggaaacagcagatgtaccctcagtacgccacctactattacccccagtatctgcaagccaagcagtctctggtcccagcccaccccatggcccctcccagtcccagcaccaccagcagtaataacaacagtagcagcagtagcaactcaggatgggatcagctcagcaaaacgaacctctatatccgaggactgcctccccacaccaccgaccaggacctggtgaagctctgtcaaccatatgggaaaatagtctccacaaaggcaattttggataagacaacgaacaaatgcaaaggttatggttttgtcgactttgacagccctgcagcagctcaaaaagctgtgtctgccctgaaggccagtggggttcaagctcaaatggcaaagcaacaggaacaagatcctaccaacctctacatttctaatttgccactctccatggatgagcaagaactagaaaatatgctcaaaccatttggacaagttatttctacaaggatactacgtgattccagtggtacaagtcgtggtgttggctttgctaggatggaatcaacagaaaaatgtgaagctgttattggtcattttaatggaaaatttattaagacaccaccaggagtttctgcccccacagaacctttattgtgtaagtttgctgatggaggacagaaaaagagacagaacccaaacaaatacatccctaatggaagaccatggcatagagaaggagaggtgagacttgctggaatgacacttacttacgacccaactacagctgctatacagaacggattttatccttcaccatacagtattgctacaaaccgaatgatcactcaaacttctattacaccctatattgcatctcctgtatctgcctaccaggtgcaaagtccttcgtggatgcaacctcaaccatatattctacagcaccctggtgccgtgttaactccctcaatggagcacaccatgtcactacagcccgcatcaatgatcagccctctggcccagcagatgagtcatctgtcactaggcagcaccggaacatacatgcctgcaacgtcagctatgcaaggagcctacttgccacagtatgcacatatgcagacgacagcggttcctgttgaggaggcaagtggtcaacagcaggtggctgtcgagacgtctaatgaccattctccatatacctttcaacctaataagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - StAR-related lipid transfer (START) domain containing 3
- StAR-related lipid transfer (START) domain containing 3
- tumor necrosis factor receptor superfamily, member 21
- X-prolyl aminopeptidase (aminopeptidase P) 3, putative

Buy RBMS1-RNA binding motif, single stranded interacting protein 1 Gene now

Add to cart