STARD3-StAR-related lipid transfer (START) domain containing 3 Gene View larger

STARD3-StAR-related lipid transfer (START) domain containing 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STARD3-StAR-related lipid transfer (START) domain containing 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about STARD3-StAR-related lipid transfer (START) domain containing 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008356
Product type: DNA & cDNA
Ncbi symbol: STARD3
Origin species: Human
Product name: STARD3-StAR-related lipid transfer (START) domain containing 3 Gene
Size: 2ug
Accessions: BC008356
Gene id: 10948
Gene description: StAR-related lipid transfer (START) domain containing 3
Synonyms: CAB1; es64; stAR-related lipid transfer protein 3; MLN 64; START domain-containing protein 3; StAR-related lipid transfer (START) domain containing 3; metastatic lymph node gene 64 protein; metastatic lymph node protein 64; steroidogenic acute regulatory protein related; StAR related lipid transfer domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcaagctgcccagggagctgacccgagacttggagcgcagcctgcctgccgtggcctccctgggctcctcactgtcccacagccagagcctctcctcgcacctccttccgccgcctgagaagcgaagggccatctctgatgtccgccgcaccttctgtctcttcgtcaccttcgacctgctcttcatctccctgctctggatcatcgaactgaataccaacacaggcatccgtaagaacttggagcaggagatcatccagtacaactttaaaacttccttcttcgacatctttgtcctggccttcttccgcttctctggactgctcctaggctatgccgtgctgcggctccggcactggtgggtgattgcggtcacgacgctggtgtccagtgcattcctcattgtcaaggtcatcctctctgagctgctcagcaaaggggcatttggctacctgctccccatcgtctcttttgtcctcgcctggttggagacctggttccttgacttcaaagtcctaccccaggaagctgaagaggagcgatggtatcttgccgcccaggttgctgttgcccgtggacccctgctgttctccggtgctctgtccgagggacagttctattcacccccagaatcctttgcagggtctgacaatgaatcagatgaagaagttgctgggaagaaaagtttctctgctcaggagcgggagtacatccgccaggggaaggaggccacggcagtggtggaccagatcttggcccaggaagagaactggaagtttgagaagaataatgaatatggggacaccgtgtacaccattgaagttccctttcacggcaagacgtttatcctgaagaccttcctgccctgtcctgcggagctcgtgtaccaggaggtgatcctgcagcccgagaggatggtgctgtggaacaagacagtgactgcctgccagatcctgcagcgagtggaagacaacaccctcatctcctatgacgtgtctgcaggggctgcgggcggcgtggtctccccaagggacttcgtgaatgtccggcgcattgagcggcgcagggaccgatacttgtcatcagggatcgccacctcacacagtgccaagcccccgacgcacaaatatgtccggggagagaatggccctgggggcttcatcgtgctcaagtcggccagtaacccccgtgtttgcacctttgtctggattcttaatacagatctcaagggccgcctgccccggtacctcatccaccagagcctcgcggccaccatgtttgaatttgcctttcacctgcgacagcgcatcagcgagctgggggcccgggcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor necrosis factor receptor superfamily, member 21
- X-prolyl aminopeptidase (aminopeptidase P) 3, putative
- DNA cross-link repair 1B (PSO2 homolog, S. cerevisiae)
- tumor necrosis factor receptor superfamily, member 21

Buy STARD3-StAR-related lipid transfer (START) domain containing 3 Gene now

Add to cart