XPNPEP3-X-prolyl aminopeptidase (aminopeptidase P) 3, putative Gene View larger

XPNPEP3-X-prolyl aminopeptidase (aminopeptidase P) 3, putative Gene

PTXBC001681

New product

Data sheet of XPNPEP3-X-prolyl aminopeptidase (aminopeptidase P) 3, putative Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about XPNPEP3-X-prolyl aminopeptidase (aminopeptidase P) 3, putative Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC001681
Product type: DNA & cDNA
Ncbi symbol: XPNPEP3
Origin species: Human
Product name: XPNPEP3-X-prolyl aminopeptidase (aminopeptidase P) 3, putative Gene
Size: 2ug
Accessions: BC001681
Gene id: 63929
Gene description: X-prolyl aminopeptidase (aminopeptidase P) 3, putative
Synonyms: APP3; ICP55; NPHPL1; Intermediate Cleaving Peptidase 55; X-Pro aminopeptidase 3; X-prolyl aminopeptidase (aminopeptidase P) 3, putative; X-prolyl aminopeptidase 3, mitochondrial; X-prolyl aminopeptidase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccttggctgctctcagcccccaagctggttcccgctgtagcaaacgtccgcggcctctcaggatgtatgttgtgttcacagcgaaggtactcccttcagcctgtcccagaaaggaggattccaaaccgatacttaggccagcccagcccctttacacacccacacctcctcagaccaggggaggtaactccaggactatctcaggtggaatatgcacttcgcagacacaaactaatgtctctgatccagaaggaagctcaagggcagagtgggacagaccagacagtggttgtgctctccaaccctacatactacatgagcaacgatattccctatactttccaccaagacaacaatttcctgtacctatgtggattccaagagcctgatagcattcttgtccttcagagcctccctggcaaacaattaccatcacacaaagccatactttttgtgcctcggcgagatcccagtcgagaactttgggatggtccgcgatctggcactgatggagcaatagctctaactggagtagacgaagcctatacgctagaagaatttcaacatcttctaccaaaaatgaaagctgagacgaacatggtttggtatgactggatgaggccctcacatgcacagcttcactctgactatatgcagcccctgactgaggccaaagccaagagcaagaacaaggttcggggtgttcagcagctgatacagcgcctccggctgatcaagtctcctgcagaaattgaacgaatgcagattgctgggaagctgacatcacaggctttcatagaaaccatgttcaccagtaaagcccctgtggaagaagcctttctttatgctaagtttgaatttgaatgccgggctcgtggcgcagacattttagcctatccacctgtggtggctggtggtaatcggtcaaacactttgcactatgtgaaaaataatcaactcatcaaggatggggaaatggtgcttctggatggaggttgtgagtcttcctgctatgtgagtgacatcacacgtacgtggccagtcaatggcaggttcaccgcacctcaggcagaactctatgaagccgttctagagatccaaagagattgtttggccctctgcttccctgggacaagcttggagaacatctacagcatgatgctgaccctgataggacagaagcttaaagacttggggatcatgaagaacattaaggaaaataatgccttcaaggctgctcgaaaatactgtcctcatcatgttggccactacctcgggatggatgtccatgacactccagacatgccccgttccctccctctgcagcctgggatggtaatcacaattgagcccggcatttatattccagaggatgacaaagatgccccagagaagtttcggggtcttggtgtacgaattgaggatgatgtagtggtgactcaggactcacctttcatcctttctgcagactgtcccaaagagatgaatgacattgaacagatatgcagccaggcttcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DNA cross-link repair 1B (PSO2 homolog, S. cerevisiae)
- tumor necrosis factor receptor superfamily, member 21
- cleft lip and palate associated transmembrane protein 1
- ArfGAP with coiled-coil, ankyrin repeat and PH domains 1

Buy XPNPEP3-X-prolyl aminopeptidase (aminopeptidase P) 3, putative Gene now

Add to cart