Login to display prices
Login to display prices
XPNPEP3-X-prolyl aminopeptidase (aminopeptidase P) 3, putative Gene View larger

XPNPEP3-X-prolyl aminopeptidase (aminopeptidase P) 3, putative Gene

PTXBC001681

New product

Data sheet of XPNPEP3-X-prolyl aminopeptidase (aminopeptidase P) 3, putative Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about XPNPEP3-X-prolyl aminopeptidase (aminopeptidase P) 3, putative Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC001681
Ncbi symbol: XPNPEP3
Product name: XPNPEP3-X-prolyl aminopeptidase (aminopeptidase P) 3, putative Gene
Size: 2ug
Accessions: BC001681
Gene id: 63929
Gene description: X-prolyl aminopeptidase (aminopeptidase P) 3, putative
Synonyms: APP3; ICP55; NPHPL1; Intermediate Cleaving Peptidase 55; X-Pro aminopeptidase 3; X-prolyl aminopeptidase (aminopeptidase P) 3, putative; X-prolyl aminopeptidase 3, mitochondrial; X-prolyl aminopeptidase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccttggctgctctcagcccccaagctggttcccgctgtagcaaacgtccgcggcctctcaggatgtatgttgtgttcacagcgaaggtactcccttcagcctgtcccagaaaggaggattccaaaccgatacttaggccagcccagcccctttacacacccacacctcctcagaccaggggaggtaactccaggactatctcaggtggaatatgcacttcgcagacacaaactaatgtctctgatccagaaggaagctcaagggcagagtgggacagaccagacagtggttgtgctctccaaccctacatactacatgagcaacgatattccctatactttccaccaagacaacaatttcctgtacctatgtggattccaagagcctgatagcattcttgtccttcagagcctccctggcaaacaattaccatcacacaaagccatactttttgtgcctcggcgagatcccagtcgagaactttgggatggtccgcgatctggcactgatggagcaatagctctaactggagtagacgaagcctatacgctagaagaatttcaacatcttctaccaaaaatgaaagctgagacgaacatggtttggtatgactggatgaggccctcacatgcacagcttcactctgactatatgcagcccctgactgaggccaaagccaagagcaagaacaaggttcggggtgttcagcagctgatacagcgcctccggctgatcaagtctcctgcagaaattgaacgaatgcagattgctgggaagctgacatcacaggctttcatagaaaccatgttcaccagtaaagcccctgtggaagaagcctttctttatgctaagtttgaatttgaatgccgggctcgtggcgcagacattttagcctatccacctgtggtggctggtggtaatcggtcaaacactttgcactatgtgaaaaataatcaactcatcaaggatggggaaatggtgcttctggatggaggttgtgagtcttcctgctatgtgagtgacatcacacgtacgtggccagtcaatggcaggttcaccgcacctcaggcagaactctatgaagccgttctagagatccaaagagattgtttggccctctgcttccctgggacaagcttggagaacatctacagcatgatgctgaccctgataggacagaagcttaaagacttggggatcatgaagaacattaaggaaaataatgccttcaaggctgctcgaaaatactgtcctcatcatgttggccactacctcgggatggatgtccatgacactccagacatgccccgttccctccctctgcagcctgggatggtaatcacaattgagcccggcatttatattccagaggatgacaaagatgccccagagaagtttcggggtcttggtgtacgaattgaggatgatgtagtggtgactcaggactcacctttcatcctttctgcagactgtcccaaagagatgaatgacattgaacagatatgcagccaggcttcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: