Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GAMT-guanidinoacetate N-methyltransferase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GAMT-guanidinoacetate N-methyltransferase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016760 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GAMT |
| Origin species: | Human |
| Product name: | GAMT-guanidinoacetate N-methyltransferase Gene |
| Size: | 2ug |
| Accessions: | BC016760 |
| Gene id: | 2593 |
| Gene description: | guanidinoacetate N-methyltransferase |
| Synonyms: | CCDS2; HEL-S-20; PIG2; TP53I2; guanidinoacetate N-methyltransferase; epididymis secretory protein Li 20 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcgcccccagcgcgacccccatcttcgcgcccggcgagaactgcagccccgcgtggggggcggcgcccgcggcctacgacgcagcggacacgcacctgcgcatcctgggcaagccggtgatggagcgctgggagaccccctatatgcacgcgctggccgccgccgcctcctccaaagggggccgggtcctggaggtgggctttggcatggccatcgcagcgtcaaaggtgcaggaggcgcccattgatgagcattggatcatcgagtgcaatgacggcgtcttccagcggctccgggactgggccccacggcagacacacaaggtcatccccttgaaaggcctgtgggaggatgtggcacccaccctgcctgacggtcactttgatgggatcctgtacgacacgtacccactctcggaggagacctggcacacacaccagttcaacttcatcaagaaccacgcctttcgcctgctgaagccggggggcgtcctcacctactgcaacctcacctcctggggggagctgatgaagtccaagtactcagacatcaccatcatgtttgaggagacgcaggtgcccgcgctgctggaggccggcttccggagggagaacatccgtacggaggtgatggcgctggtcccaccggccgactgccgctactacgccttcccacagatgatcacgcccctggtgaccaaaggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - acid phosphatase 6, lysophosphatidic - nuclear mitotic apparatus protein 1 - ecotropic viral integration site 2A - serine/arginine repetitive matrix 1 |