MYOZ2-myozenin 2 Gene View larger

MYOZ2-myozenin 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MYOZ2-myozenin 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MYOZ2-myozenin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005195
Product type: DNA & cDNA
Ncbi symbol: MYOZ2
Origin species: Human
Product name: MYOZ2-myozenin 2 Gene
Size: 2ug
Accessions: BC005195
Gene id: 51778
Gene description: myozenin 2
Synonyms: C4orf5; CMH16; CS-1; myozenin-2; FATZ-related protein 2; calcineurin-binding protein calsarcin-1; muscle-specific protein; myozenin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctatcacataatactatgatgaagcagagaaaacagcaagcaacagccatcatgaaggaagtccatggaaatgatgttgatggcatggacctgggcaaaaaggtcagcatccccagagacatcatgttggaagaattatcccatctcagtaaccgtggtgccaggctatttaagatgcgtcaaagaagatctgacaaatacacatttgaaaatttccagtatcaatctagagcacaaataaatcacagtattgctatgcagaatgggaaagtggatggaagtaacttggaaggtggttcgcagcaagcccccttgactcctcccaacaccccagatccacgaagccctccaaatccagacaacattgctccaggatattctggaccactgaaggaaattcctcctgaaaaattcaacaccacagctgtccctaagtactatcaatctccctgggaacaagccattagcaatgatccggagcttttagaggctttatatcctaaacttttcaagcctgaaggaaaggcagaactgcctgattacaggagctttaacagggttgccacaccatttggaggttttgaaaaagcatcaagaatggttaaatttaaagttccagattttgagctactattgctaacagatcccaggtttatgtcctttgtcaatcccctttctggcagacggtcctttaataggactcctaagggatggatatctgagaatattcctatagtgataacaaccgaacctacagatgataccactgtaccagaatcagaagacctatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - secernin 2
- cathepsin A
- hexokinase 1
- TBP-like 1

Buy MYOZ2-myozenin 2 Gene now

Add to cart