Login to display prices
Login to display prices
TBPL1-TBP-like 1 Gene View larger

TBPL1-TBP-like 1 Gene

PTXBC000381

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TBPL1-TBP-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TBPL1-TBP-like 1 Gene

Proteogenix catalog: PTXBC000381
Ncbi symbol: TBPL1
Product name: TBPL1-TBP-like 1 Gene
Size: 2ug
Accessions: BC000381
Gene id: 9519
Gene description: TBP-like 1
Synonyms: MGC:8389; MGC:9620; STUD; TLF; TLP; TRF2; TATA box-binding protein-like protein 1; 21-kDA TBP-like protein; TATA box-binding protein-related factor 2; TBP-like 1; TBP-related factor 2; TBP-related protein; second TBP of unique DNA protein; TATA-box binding protein like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgcagacagtgatgttgcattggacattctaattacaaatgtagtctgtgtttttagaacaagatgtcatttaaacttaaggaagattgctttggaaggagcaaatgtaatttataaacgtgatgctggaaaagtattaatgaagcttagaaaacctagaattacagctacaatttggtcctcaggaaaaattatttgcactggagcaacaagtgaagaagaagctaaatttggtgccagacgcttagcccgtagtctgcagaaactaggttttcaggtaatatttacagattttaaggttgttaacgttctggcagtgtgtaacatgccatttgaaatccgtttgccagaattcacaaagaacaatagacctcatgccagttacgaacctgaacttcatcctgctgtgtgctatcggataaaatctctaagagctacattacagattttttcaacaggaagtatcacagtaacagggcccaatgtaaaggctgttgctactgctgtggaacagatttacccatttgtgtttgaaagcaggaaagaaattttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: