AKIRIN2-akirin 2 Gene View larger

AKIRIN2-akirin 2 Gene

PTXBC000764

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AKIRIN2-akirin 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AKIRIN2-akirin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000764
Product type: DNA & cDNA
Ncbi symbol: AKIRIN2
Origin species: Human
Product name: AKIRIN2-akirin 2 Gene
Size: 2ug
Accessions: BC000764
Gene id: 55122
Gene description: akirin 2
Synonyms: C6orf166; FBI1; dJ486L4.2; akirin-2; fourteen-three-three beta interactant 1; akirin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtgcggagccactctgaaaaggactctggatttcgacccgctgttgagcccggcgtccccgaagcgcaggcgatgtgcgccattgtcggcgcccacctcggccgctgcctccccgttgtcggcggccgcggccaccgccgcctccttctccgctgcggccgcctcgccgcagaagtatctccgaatggagccatcccccttcggcgacgtctcctcccgcctcaccacagaacaaattctgtacaacataaaacaagagtataaacgaatgcagaagagaagacatttagaaacgagtttccaacagacagatccgtgttgtacttctgatgcacagccacatgcatttctcctcagtggaccagcttcaccagggacttcatctgcagcatcctcaccattaaaaaaagaacagcccttatttactctacggcaggttgggatgatctgtgaacgtttgttgaaagaacgtgaagagaaagttcgagaagaatatgaagaaatattgaacacaaaacttgcagaacaatatgatgcgtttgtgaagtttacgcatgatcaaataatgcgacgatatggagaacagcctgctagctatgtttcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - plexin A1
- cathepsin K
- rhotekin 2
- keratin 18

Buy AKIRIN2-akirin 2 Gene now

Add to cart