RTKN2-rhotekin 2 Gene View larger

RTKN2-rhotekin 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RTKN2-rhotekin 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RTKN2-rhotekin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025765
Product type: DNA & cDNA
Ncbi symbol: RTKN2
Origin species: Human
Product name: RTKN2-rhotekin 2 Gene
Size: 2ug
Accessions: BC025765
Gene id: 219790
Gene description: rhotekin 2
Synonyms: PLEKHK1; bA531F24.1; rhotekin-2; PH domain-containing family K member 1; pleckstrin homology domain-containing family K member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggggccgagcctgaggggtcctgcgctccgcctggcggggcttcccacccagcaggactgcaacattcaagaaaaaatagacttagaaattcgaatgcgagaaggaatatggaaactcctttctctgagcactcagaaagatcaagttttacatgcagttaagaatctcatggtgtgcaatgctcgactaatggcctatacatcggagctacagaaattagaagaacagattgcaaatcagactggaagatgtgatgtgaaatttgaaagtaaagaacgaacagcatgtaaaggaaagattgccatatcagatattcgaataccactaatgtggaaagactctgatcacttcagcaataaagaacgatcacgacgctatgccattttttgtttattcaaaatgggagctaatgtgtttgatactgatgtggtgaatgtggataaaacaatcacagatatatgttttgaaaatgtaaccatattgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - keratin 18
- peptidase D
- neuromedin U
- TBP-like 1

Buy RTKN2-rhotekin 2 Gene now

Add to cart