Login to display prices
Login to display prices
RTKN2-rhotekin 2 Gene View larger

RTKN2-rhotekin 2 Gene

PTXBC025765

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RTKN2-rhotekin 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RTKN2-rhotekin 2 Gene

Proteogenix catalog: PTXBC025765
Ncbi symbol: RTKN2
Product name: RTKN2-rhotekin 2 Gene
Size: 2ug
Accessions: BC025765
Gene id: 219790
Gene description: rhotekin 2
Synonyms: PLEKHK1; bA531F24.1; rhotekin-2; PH domain-containing family K member 1; pleckstrin homology domain-containing family K member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggggccgagcctgaggggtcctgcgctccgcctggcggggcttcccacccagcaggactgcaacattcaagaaaaaatagacttagaaattcgaatgcgagaaggaatatggaaactcctttctctgagcactcagaaagatcaagttttacatgcagttaagaatctcatggtgtgcaatgctcgactaatggcctatacatcggagctacagaaattagaagaacagattgcaaatcagactggaagatgtgatgtgaaatttgaaagtaaagaacgaacagcatgtaaaggaaagattgccatatcagatattcgaataccactaatgtggaaagactctgatcacttcagcaataaagaacgatcacgacgctatgccattttttgtttattcaaaatgggagctaatgtgtttgatactgatgtggtgaatgtggataaaacaatcacagatatatgttttgaaaatgtaaccatattgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: