TBPL1-TBP-like 1 Gene View larger

TBPL1-TBP-like 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TBPL1-TBP-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TBPL1-TBP-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017559
Product type: DNA & cDNA
Ncbi symbol: TBPL1
Origin species: Human
Product name: TBPL1-TBP-like 1 Gene
Size: 2ug
Accessions: BC017559
Gene id: 9519
Gene description: TBP-like 1
Synonyms: MGC:8389; MGC:9620; STUD; TLF; TLP; TRF2; TATA box-binding protein-like protein 1; 21-kDA TBP-like protein; TATA box-binding protein-related factor 2; TBP-like 1; TBP-related factor 2; TBP-related protein; second TBP of unique DNA protein; TATA-box binding protein like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgcagacagtgatgttgcattggacattctaattacaaatgtagtctgtgtttttagaacaagatgtcatttaaacttaaggaagattgctttggaaggagcaaatgtaatttataaacgtgatgttggaaaagtattaatgaagcttagaaaacctagaattacagctacaatttggtcctcaggaaaaattatttgcactggagcaacaagtgaagaagaagctaaatttggtgccagacgcttagcccgtagtctgcagaaactaggttttcaggtaatatttacagattttaaggttgttaacgttctggcagtgtgtaacatgccatttgaaatccgtttgccagaattcacaaagaacaatagacctcatgccagttacgaacctgaacttcatcctgctgtgtgctatcggataaaatctctaagagctacattacagattttttcaacaggaagtatcacagtaacagggcccaatgtaaaggctgttgctactgctgtggaacagatttacccatttgtgtttgaaagcaggaaagaaattttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - reticulon 4
- sialidase 4
- spindlin 1
- aquaporin 5

Buy TBPL1-TBP-like 1 Gene now

Add to cart