RTN4-reticulon 4 Gene View larger

RTN4-reticulon 4 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RTN4-reticulon 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RTN4-reticulon 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001035
Product type: DNA & cDNA
Ncbi symbol: RTN4
Origin species: Human
Product name: RTN4-reticulon 4 Gene
Size: 2ug
Accessions: BC001035
Gene id: 57142
Gene description: reticulon 4
Synonyms: RTN4-C; RTN4-B2; RTN4-B1; RTN4-A; ASY; NI220/250; NOGO; NOGO-A; NOGOC; NSP; NSP-CL; Nbla00271; Nbla10545; Nogo-B; Nogo-C; RTN-X; reticulon-4; Human NogoA; My043 protein; foocen; neurite growth inhibitor 220; neurite outgrowth inhibitor; neuroendocrine-specific protein C homolog; reticulon 5; reticulon 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacggtcagaagaaaaattggaaggacaaggttgttgacctcctgtactggagagacattaagaagactggagtggtgtttggtgccagcctattcctgctgctttcattgacagtattcagcattgtgagcgtaacagcctacattgccttggccctgctctctgtgaccatcagctttaggatatacaagggtgtgatccaagctatccagaaatcagatgaaggccacccattcagggcatatctggaatctgaagttgctatatctgaggagttggttcagaagtacagtaattctgctcttggtcatgtgaactgcacgataaaggaactcaggcgcctcttcttagttgatgatttagttgattctctgaagtttgcagtgttgatgtgggtatttacctatgttggtgccttgtttaatggtctgacactactgattttggctctcatttcactcttcagtgttcctgttatttatgaacggcatcaggcacagatagatcattatctaggacttgcaaataagaatgttaaagatgctatggctaaaatccaagcaaaaatccctggattgaagcgcaaagctgaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sialidase 4
- spindlin 1
- aquaporin 5
- annexin A5

Buy RTN4-reticulon 4 Gene now

Add to cart