SPIN1-spindlin 1 Gene View larger

SPIN1-spindlin 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPIN1-spindlin 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SPIN1-spindlin 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013571
Product type: DNA & cDNA
Ncbi symbol: SPIN1
Origin species: Human
Product name: SPIN1-spindlin 1 Gene
Size: 2ug
Accessions: BC013571
Gene id: 10927
Gene description: spindlin 1
Synonyms: SPIN; TDRD24; spindlin-1; ovarian cancer-related protein; spindlin1; spindlin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagaccccattcggaaagacacctggccagcggtccagagctgatgcaggccatgctggagtatctgccaacatgatgaagaagaggacatcccacaaaaaacatcggagcagtgtgggtccgagcaaacctgtttcccagccccggcggaacatcgtaggctgcaggattcagcatgggtggaaagaggggaatggccctgttacccagtggaaaggaaccgttctggaccaggtgcctgtaaatccttctttgtatcttataaaatacgatggatttgactgtgtttatggactagaacttaataaagatgaaagagtttctgcgcttgaagtcctccctgatagagttgcgacatctcgaatcagcgatgcacacttggcagacacaatgattggcaaagcagtggaacatatgtttgagacagaggatggttctaaagatgagtggaggggaatggtcttagcacgtgcacctgtcatgaacacatggttttacattacctatgagaaagaccctgtcttgtacatgtaccaactcttagatgattacaaagaaggcgaccttcgcattatgcctgattccaatgattcacctccagcagaaagggaaccaggagaagttgtggacagcctggtaggcaaacaagtggaatatgccaaagaagatggctcgaaaaggactggcatggtcattcatcaagtagaagccaagccctccgtctatttcatcaagtttgatgatgatttccatatttatgtctacgatttggtgaaaacatcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aquaporin 5
- annexin A5
- bystin-like
- cathepsin S

Buy SPIN1-spindlin 1 Gene now

Add to cart