CTSS-cathepsin S Gene View larger

CTSS-cathepsin S Gene

PTXBC002642

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTSS-cathepsin S Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CTSS-cathepsin S Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002642
Product type: DNA & cDNA
Ncbi symbol: CTSS
Origin species: Human
Product name: CTSS-cathepsin S Gene
Size: 2ug
Accessions: BC002642
Gene id: 1520
Gene description: cathepsin S
Synonyms: cathepsin S
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaacggctggtttgtgtgctcttggtgtgctcctctgcagtggcacagttgcataaagatcctaccctggatcaccactggcatctctggaagaaaacctatggcaaacaatacaaggaaaagaatgaagaagcagtacgacgtctcatctgggaaaagaatctaaagtttgtgatgcttcacaacctggagcattcaatgggaatgcactcatacgatctgggcatgaaccacctgggagacatgaccagtgaagaagtgatgtctttgatgagttccctgagagttcccagccagtggcagagaaatatcacatataagtcaaaccctaattggatattgcctgattctgtggactggagagagaaagggtgtgttactgaagtgaaatatcaaggttcttgtggtgcttgctgggctttcagtgctgtgggggccctggaagcacagctgaagctgaaaacaggaaagctggtgtctctcagtgcccagaacctggtggattgctcaactgaaaaatatggaaacaaaggctgcaatggtggcttcatgacaacggctttccagtacatcattgataacaagggcatcgactcagacgcttcctatccctacaaagccatggatcagaaatgtcaatatgactcaaaatatcgtgctgccacatgttcaaagtacactgaacttccttatggcagagaagatgtcctgaaagaagctgtggccaataaaggcccagtgtctgttggtgtagatgcgcgtcatccttctttcttcctctacagaagtggtgtctactatgaaccatcctgtactcagaatgtgaatcatggtgtacttgtggttggctatggtgatcttaatgggaaagaatactggcttgtgaaaaacagctggggccacaactttggtgaagaaggatatattcggatggcaagaaataaaggaaatcattgtgggattgctagctttccctcttacccagaaatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - annexin A9
- annexin A2
- cathepsin B
- annexin A1

Buy CTSS-cathepsin S Gene now

Add to cart