Cart 14 Product Products 1 744,00 € (empty)
-
1 x KHK-ketohe...121,50 € -
1 x ZNF446-zin...121,50 € -
1 x PARK2-Park...121,50 € -
1 x IL33-inter...121,50 € -
1 x KLK15-kall...113,40 € -
1 x PLVAP-plas...121,50 € -
1 x LSM14A-LSM...121,50 € -
1 x STAT5B-sig...121,50 € -
1 x HIST1H4F-h...113,40 € -
-
1 x TMEM180-tr...113,40 € -
1 x LYPLA1-lys...113,40 € -
1 x KCNN3-pota...121,50 € -
1 x MRPL53-mit...113,40 €
No products
To be determined Shipping
1 744,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 14 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 744,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 744,00 €
Data sheet of CTSB-cathepsin B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CTSB-cathepsin B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010240 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CTSB |
| Origin species: | Human |
| Product name: | CTSB-cathepsin B Gene |
| Size: | 2ug |
| Accessions: | BC010240 |
| Gene id: | 1508 |
| Gene description: | cathepsin B |
| Synonyms: | APPS; CPSB; APP secretase; amyloid precursor protein secretase; cathepsin B1; cysteine protease |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggcagctctgggcctccctctgctgcctgctggtgttggccaatgcccggagcaggccctctttccatcccgtgtcggatgagctggtcaactatgtcaacaaacggaataccacgtggcaggccgggcacaacttctacaacgtggacatgggctacttgaagaggctatgtggtaccttcctgggtgggcccaagccaccccagagagttatgtttaccgaggacctgaagctgcctgcaagcttcgatgcacgggaacaatggccacagtgtcccaccatcaaagagatcagagaccagggctcctgtggctcctgctgggccttcggggctgtggaagccatctctgaccggatctgcatccacaccaatgcgcacgtcagcgtggaggtgtcggcggaggacctgctcacctgctgtggcagcatgtgtggggacggctgtaatggtggctatcctgctgaagcttggaacttctggacaagaaaaggcctggtttctggtggcctctatgaatcccatgtagggtgcagaccgtactccatccctccctgtgagcaccacgtcaacggctcccggcccccatgcacgggggagggagatacccccaagtgtagcaagatctgtgagcctggctacagcccgacctacaaacaggacaagcactacggatacaattcctacagcgtctccaatagcgagaaggacatcatggccgagatctacaaaaacggccccgtggagggagctttctctgtgtattcggacttcctgctctacaagtcaggagtgtaccaacacgtcaccggagagatgatgggtggccatgccatccgcatcctgggctggggagtggagaatggcacaccctactggctggttgccaactcctggaacactgactggggtgacaatggcttctttaaaatactcagaggacaggatcactgtggaatcgaatcagaagtggtggctggaattccacgcaccgatcagtactgggaaaagatctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - annexin A1 - CD2 molecule - doublecortin - tuftelin 1 |