CTSB-cathepsin B Gene View larger

CTSB-cathepsin B Gene

PTXBC010240

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTSB-cathepsin B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CTSB-cathepsin B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010240
Product type: DNA & cDNA
Ncbi symbol: CTSB
Origin species: Human
Product name: CTSB-cathepsin B Gene
Size: 2ug
Accessions: BC010240
Gene id: 1508
Gene description: cathepsin B
Synonyms: APPS; CPSB; APP secretase; amyloid precursor protein secretase; cathepsin B1; cysteine protease
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggcagctctgggcctccctctgctgcctgctggtgttggccaatgcccggagcaggccctctttccatcccgtgtcggatgagctggtcaactatgtcaacaaacggaataccacgtggcaggccgggcacaacttctacaacgtggacatgggctacttgaagaggctatgtggtaccttcctgggtgggcccaagccaccccagagagttatgtttaccgaggacctgaagctgcctgcaagcttcgatgcacgggaacaatggccacagtgtcccaccatcaaagagatcagagaccagggctcctgtggctcctgctgggccttcggggctgtggaagccatctctgaccggatctgcatccacaccaatgcgcacgtcagcgtggaggtgtcggcggaggacctgctcacctgctgtggcagcatgtgtggggacggctgtaatggtggctatcctgctgaagcttggaacttctggacaagaaaaggcctggtttctggtggcctctatgaatcccatgtagggtgcagaccgtactccatccctccctgtgagcaccacgtcaacggctcccggcccccatgcacgggggagggagatacccccaagtgtagcaagatctgtgagcctggctacagcccgacctacaaacaggacaagcactacggatacaattcctacagcgtctccaatagcgagaaggacatcatggccgagatctacaaaaacggccccgtggagggagctttctctgtgtattcggacttcctgctctacaagtcaggagtgtaccaacacgtcaccggagagatgatgggtggccatgccatccgcatcctgggctggggagtggagaatggcacaccctactggctggttgccaactcctggaacactgactggggtgacaatggcttctttaaaatactcagaggacaggatcactgtggaatcgaatcagaagtggtggctggaattccacgcaccgatcagtactgggaaaagatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - annexin A1
- CD2 molecule
- doublecortin
- tuftelin 1

Buy CTSB-cathepsin B Gene now

Add to cart