Login to display prices
Login to display prices
NMU-neuromedin U Gene View larger

NMU-neuromedin U Gene

PTXBC012908

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NMU-neuromedin U Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NMU-neuromedin U Gene

Proteogenix catalog: PTXBC012908
Ncbi symbol: NMU
Product name: NMU-neuromedin U Gene
Size: 2ug
Accessions: BC012908
Gene id: 10874
Gene description: neuromedin U
Synonyms: prepro-NMU; neuromedin-U
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgcgaacagagagctgccgccccaggtcgcccgccggacaggtggccgcggcgtccccgctcctgctgctgctgctgctgctcgcctggtgcgcgggcgcctgccgaggtgctccaatattacctcaaggattacagcctgaacaacagctacagttgtggaatgagatagatgatacttgttcgtcttttctgtccattgattctcagcctcaggcatccaatgcactggaggagctttgctttatgattatgggaatgctaccaaagcctcaggaacaagatgaaaaagataatactaaaaggttcttatttcattattcgaagacacagaagttgggcaagtcaaatgttgtgtcgtcagttgtgcatccgttgctgcagctcgttcctcacctgcatgagagaagaatgaagagattcagagtggacgaagaattccaaagtccctttgcaagtcaaagtcgaggatattttttattcaggccacggaatggaagaaggtcagcagggttcatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice