PLXNA1-plexin A1 Gene View larger

PLXNA1-plexin A1 Gene

PTXBC032432

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLXNA1-plexin A1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PLXNA1-plexin A1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032432
Product type: DNA & cDNA
Ncbi symbol: PLXNA1
Origin species: Human
Product name: PLXNA1-plexin A1 Gene
Size: 2ug
Accessions: BC032432
Gene id: 5361
Gene description: plexin A1
Synonyms: NOV; NOVP; PLEXIN-A1; PLXN1; plexin 1; semaphorin receptor NOV; plexin A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagggggtgcaccacaggcctcatgaagcagttcccacatgggcgtgtggctggggcgtggccaccacagagcacatggctgtgtctaggcgcaagcactttagcagtatctgtttacatgcgcaaggatcaagccgactacctgtgctgtctactgggacagcagtctccgagctactccgtacctccctctgccaggtcgtggagttaggccccagtccctacttgtcactggttcccactgtgctcctaactgtgcagcacctgggagctctggcctggggctggaggccctggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cathepsin K
- rhotekin 2
- keratin 18
- peptidase D

Buy PLXNA1-plexin A1 Gene now

Add to cart