CTSK-cathepsin K Gene View larger

CTSK-cathepsin K Gene

PTXBC016058

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTSK-cathepsin K Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CTSK-cathepsin K Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016058
Product type: DNA & cDNA
Ncbi symbol: CTSK
Origin species: Human
Product name: CTSK-cathepsin K Gene
Size: 2ug
Accessions: BC016058
Gene id: 1513
Gene description: cathepsin K
Synonyms: CTS02; CTSO; CTSO1; CTSO2; PKND; PYCD; cathepsin K; cathepsin O; cathepsin O1; cathepsin O2; cathepsin X
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggggctcaaggttctgctgctacctgtggtgagctttgctctgtaccctgaggagatactggacacccactgggagctatggaagaagacccacaggaagcaatataacaacaaggtggatgaaatctctcggcgtttaatttgggaaaaaaacctgaagtatatttccatccataaccttgaggcttctcttggtgtccatacatatgaactggctatgaaccacctgggggacatgaccagtgaagaggtggttcagaagatgactggactcaaagtacccctgtctcattcccgcagtaatgacaccctttatatcccagaatgggaaggtagagccccagactctgtcgactatcgaaagaaaggatatgttactcctgtcaaaaatcagggtcagtgtggttcctgttgggcttttagctctgtgggtgccctggagggccaactcaagaagaaaactggcaaactcttaaatctgagtccccagaacctagtggattgtgtgtctgagaatgatggctgtggagggggctacatgaccaatgccttccaatatgtgcagaagaaccggggtattgactctgaagatgcctacccatatgtgggacaggaagagagttgtatgtacaacccaacaggcaaggcagctaaatgcagagggtacagagagatccccgaggggaatgagaaagccctgaagagggcagtggcccgagtgggacctgtctctgtggccattgatgcaagcctgacctccttccagttttacagcaaaggtgtgtattatgatgaaagctgcaatagcgataatctgaaccatgcggttttggcagtgggatatggaatccagaagggaaacaagcactggataattaaaaacagctggggagaaaactggggaaacaaaggatatatcctcatggctcgaaataagaacaacgcctgtggcattgccaacctggccagcttccccaagatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - rhotekin 2
- keratin 18
- peptidase D
- neuromedin U

Buy CTSK-cathepsin K Gene now

Add to cart