Cart 2 Product Products 291,80 € (empty)
-
1 x ORC6L-orig...113,40 € -
No products
To be determined Shipping
291,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 291,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 291,80 €
Data sheet of CTSK-cathepsin K Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CTSK-cathepsin K Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016058 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CTSK |
| Origin species: | Human |
| Product name: | CTSK-cathepsin K Gene |
| Size: | 2ug |
| Accessions: | BC016058 |
| Gene id: | 1513 |
| Gene description: | cathepsin K |
| Synonyms: | CTS02; CTSO; CTSO1; CTSO2; PKND; PYCD; cathepsin K; cathepsin O; cathepsin O1; cathepsin O2; cathepsin X |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgggggctcaaggttctgctgctacctgtggtgagctttgctctgtaccctgaggagatactggacacccactgggagctatggaagaagacccacaggaagcaatataacaacaaggtggatgaaatctctcggcgtttaatttgggaaaaaaacctgaagtatatttccatccataaccttgaggcttctcttggtgtccatacatatgaactggctatgaaccacctgggggacatgaccagtgaagaggtggttcagaagatgactggactcaaagtacccctgtctcattcccgcagtaatgacaccctttatatcccagaatgggaaggtagagccccagactctgtcgactatcgaaagaaaggatatgttactcctgtcaaaaatcagggtcagtgtggttcctgttgggcttttagctctgtgggtgccctggagggccaactcaagaagaaaactggcaaactcttaaatctgagtccccagaacctagtggattgtgtgtctgagaatgatggctgtggagggggctacatgaccaatgccttccaatatgtgcagaagaaccggggtattgactctgaagatgcctacccatatgtgggacaggaagagagttgtatgtacaacccaacaggcaaggcagctaaatgcagagggtacagagagatccccgaggggaatgagaaagccctgaagagggcagtggcccgagtgggacctgtctctgtggccattgatgcaagcctgacctccttccagttttacagcaaaggtgtgtattatgatgaaagctgcaatagcgataatctgaaccatgcggttttggcagtgggatatggaatccagaagggaaacaagcactggataattaaaaacagctggggagaaaactggggaaacaaaggatatatcctcatggctcgaaataagaacaacgcctgtggcattgccaacctggccagcttccccaagatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - rhotekin 2 - keratin 18 - peptidase D - neuromedin U |