RTN1-reticulon 1 Gene View larger

RTN1-reticulon 1 Gene

PTXBC000314

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RTN1-reticulon 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RTN1-reticulon 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000314
Product type: DNA & cDNA
Ncbi symbol: RTN1
Origin species: Human
Product name: RTN1-reticulon 1 Gene
Size: 2ug
Accessions: BC000314
Gene id: 6252
Gene description: reticulon 1
Synonyms: NSP; reticulon-1; neuroendocrine-specific protein; reticulon 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactgtgtgtggagcaactggaaaagtcaggctattgacctgttgtattggcgggacatcaagcagacgggcatcgtgtttgggagtttcctgctgctgctcttctccctgacccagttcagcgtggtgagcgtcgtggcctacctggccctggccgcactctcagccaccatcagtttccgcatctacaagtctgttttacaagcagtgcagaaaaccgacgaaggccaccctttcaaggcctacttggagcttgagatcaccctttctcaggagcagattcagaagtacacggactgcctgcagttctacgtgaacagcacacttaaggaactgaggaggctcttccttgtccaggacctggtggattccttaaaatttgcagtcctgatgtggctcctgacctacgttggcgctctcttcaatggcctgaccctgctgctcatggctgtggtttcaatgtttactctacctgtagtgtatgttaagcaccaggcacagattgaccaatatctgggacttgtgaggactcacataaatgctgttgtggcaaagattcaggctaaaatcccaggcgctaagaggcacgctgagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - akirin 2
- plexin A1
- cathepsin K
- rhotekin 2

Buy RTN1-reticulon 1 Gene now

Add to cart