CTSA-cathepsin A Gene View larger

CTSA-cathepsin A Gene

PTXBC000597

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTSA-cathepsin A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CTSA-cathepsin A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000597
Product type: DNA & cDNA
Ncbi symbol: CTSA
Origin species: Human
Product name: CTSA-cathepsin A Gene
Size: 2ug
Accessions: BC000597
Gene id: 5476
Gene description: cathepsin A
Synonyms: GLB2; GSL; NGBE; PPCA; PPGB; lysosomal protective protein; beta-galactosidase 2; beta-galactosidase protective protein; carboxypeptidase C; carboxypeptidase Y-like kininase; carboxypeptidase-L; deamidase; lysosomal carboxypeptidase A; protective protein cathepsin A; urinary kininase; cathepsin A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatccgagccgcgccgccgccgctgttcctgctgctgctgctgctgctgctagtgtcctgggcgtcccgaggcgaggcagcccccgaccaggacgagatccagcgcctccccgggctggccaagcagccgtctttccgccagtactccggctacctcaaaggctccggctccaagcacctccactactggtttgtggagtcccagaaggatcccgagaacagccctgtggtgctttggctcaatgggggtcccggctgcagctcactagatgggctcctcacagagcatggccccttcctggtccagccagatggtgtcaccctggagtacaacccctattcttggaatctgattgccaatgtgttatacctggagtccccagctggggtgggcttctcctactccgatgacaagttttatgcaactaatgacactgaggtcgcccagagcaattttgaggcccttcaagatttcttccgcctctttccggagtacaagaacaacaaacttttcctgaccggggagagctatgctggcatctacatccccaccctggccgtgctggtcatgcaggatcccagcatgaaccttcaggggctggctgtgggcaatggactctcctcctatgagcagaatgacaactccctggtctactttgcctactaccatggccttctggggaacaggctttggtcttctctccagacccactgctgctctcaaaacaagtgtaacttctatgacaacaaagacctggaatgcgtgaccaatcttcaggaagtggcccgcatcgtgggcaactctggcctcaacatctacaatctctatgccccgtgtgctggaggggtgcccagccattttaggtatgagaaggacactgttgtggtccaggatttgggcaacatcttcactcgcctgccactcaagcggatgtggcatcaggcactgctgcgctcaggggataaagtgcgcatggaccccccctgcaccaacacaacagctgcttccacctacctcaacaacccgtacgtgcggaaggccctcaacatcccggagcagctgccacaatgggacatgtgcaactttctggtaaacttacagtaccgccgtctctaccgaagcatgaactcccagtatctgaagctgcttagctcacagaaataccagatcctattatataatggagatgtagacatggcctgcaatttcatgggggatgagtggtttgtggattccctcaaccagaagatggaggtgcagcgccggccctggttagtgaagtacggggacagcggggagcagattgccggcttcgtgaaggagttctcccacatcgcctttctcacgatcaagggcgccggccacatggttcccaccgacaagcccctcgctgccttcaccatgttctcccgcttcctgaacaagcagccatactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hexokinase 1
- TBP-like 1
- reticulon 1
- akirin 2

Buy CTSA-cathepsin A Gene now

Add to cart