Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MDM1-Mdm1 nuclear protein homolog (mouse) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MDM1-Mdm1 nuclear protein homolog (mouse) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022042 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MDM1 |
| Origin species: | Human |
| Product name: | MDM1-Mdm1 nuclear protein homolog (mouse) Gene |
| Size: | 2ug |
| Accessions: | BC022042 |
| Gene id: | 56890 |
| Gene description: | Mdm1 nuclear protein homolog (mouse) |
| Synonyms: | Mdm1 nuclear protein; Mdm1 nuclear protein homolog; nuclear protein MDM1; Mdm4, transformed 3T3 cell double minute 1, p53 binding protein; nuclear protein double minute 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggtgcgcttcaaggggctgagtgaataccagaggaacttcctgtggaaaaagtcttatttgtcagagtcttgtaattcctccgtggggcgaaagtacccatgggctggacttagatcagatcaattaggaaatcaaggcagatgtagaaccaagatccagcacagtgacatctcatcccttctcatcttggtctgctccacataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - reactive oxygen species modulator 1 - barrier to autointegration factor 1 - inhibitor of growth family, member 3 - ankyrin repeat domain 26-like 1 |