MDM1-Mdm1 nuclear protein homolog (mouse) Gene View larger

MDM1-Mdm1 nuclear protein homolog (mouse) Gene

PTXBC022042

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MDM1-Mdm1 nuclear protein homolog (mouse) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MDM1-Mdm1 nuclear protein homolog (mouse) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022042
Product type: DNA & cDNA
Ncbi symbol: MDM1
Origin species: Human
Product name: MDM1-Mdm1 nuclear protein homolog (mouse) Gene
Size: 2ug
Accessions: BC022042
Gene id: 56890
Gene description: Mdm1 nuclear protein homolog (mouse)
Synonyms: Mdm1 nuclear protein; Mdm1 nuclear protein homolog; nuclear protein MDM1; Mdm4, transformed 3T3 cell double minute 1, p53 binding protein; nuclear protein double minute 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggtgcgcttcaaggggctgagtgaataccagaggaacttcctgtggaaaaagtcttatttgtcagagtcttgtaattcctccgtggggcgaaagtacccatgggctggacttagatcagatcaattaggaaatcaaggcagatgtagaaccaagatccagcacagtgacatctcatcccttctcatcttggtctgctccacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - reactive oxygen species modulator 1
- barrier to autointegration factor 1
- inhibitor of growth family, member 3
- ankyrin repeat domain 26-like 1

Buy MDM1-Mdm1 nuclear protein homolog (mouse) Gene now

Add to cart