Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ROMO1-reactive oxygen species modulator 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ROMO1-reactive oxygen species modulator 1 Gene
| Proteogenix catalog: | PTXBC008488 |
| Ncbi symbol: | ROMO1 |
| Product name: | ROMO1-reactive oxygen species modulator 1 Gene |
| Size: | 2ug |
| Accessions: | BC008488 |
| Gene id: | 140823 |
| Gene description: | reactive oxygen species modulator 1 |
| Synonyms: | C20orf52; MTGM; MTGMP; bA353C18.2; reactive oxygen species modulator 1; PCM19; ROS modulator 1; epididymis tissue protein Li 175; glyrichin; mitochondrial targeting GXXXG protein; mitochondrial targeting GxxxG motif protein; protein MGR2 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggtggccgtgggtccctacggacagtcccagccaagctgcttcgaccgtgtcaaaatgggcttcgtgatgggttgcgccgtgggcatggcggccggggcgctcttcggcaccttttcctgtctcaggatcggaatgcggggtcgagagctgatgggcggcattgggaaaaccatgatgcagagtggcggcacctttggcacattcatggccattgggatgggcatccgatgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |