ROMO1-reactive oxygen species modulator 1 Gene View larger

ROMO1-reactive oxygen species modulator 1 Gene

PTXBC008488

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ROMO1-reactive oxygen species modulator 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ROMO1-reactive oxygen species modulator 1 Gene

Proteogenix catalog: PTXBC008488
Ncbi symbol: ROMO1
Product name: ROMO1-reactive oxygen species modulator 1 Gene
Size: 2ug
Accessions: BC008488
Gene id: 140823
Gene description: reactive oxygen species modulator 1
Synonyms: C20orf52; MTGM; MTGMP; bA353C18.2; reactive oxygen species modulator 1; PCM19; ROS modulator 1; epididymis tissue protein Li 175; glyrichin; mitochondrial targeting GXXXG protein; mitochondrial targeting GxxxG motif protein; protein MGR2 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggtggccgtgggtccctacggacagtcccagccaagctgcttcgaccgtgtcaaaatgggcttcgtgatgggttgcgccgtgggcatggcggccggggcgctcttcggcaccttttcctgtctcaggatcggaatgcggggtcgagagctgatgggcggcattgggaaaaccatgatgcagagtggcggcacctttggcacattcatggccattgggatgggcatccgatgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

Buy ROMO1-reactive oxygen species modulator 1 Gene now

Add to cart