ING3-inhibitor of growth family, member 3 Gene View larger

ING3-inhibitor of growth family, member 3 Gene

PTXBC009776

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ING3-inhibitor of growth family, member 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ING3-inhibitor of growth family, member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009776
Product type: DNA & cDNA
Ncbi symbol: ING3
Origin species: Human
Product name: ING3-inhibitor of growth family, member 3 Gene
Size: 2ug
Accessions: BC009776
Gene id: 54556
Gene description: inhibitor of growth family, member 3
Synonyms: Eaf4; ING2; MEAF4; p47ING3; inhibitor of growth protein 3; inhibitor of growth family member 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggagggaagagcaaatggcatccatcaaaaaagactactataaagctttggaagatgcagatgagaaggttcagttggcaaaccagatatatgacttgcagcacttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat domain 26-like 1
- calcitonin-related polypeptide beta
- coiled-coil domain containing 28A
- natural killer cell group 7 sequence

Buy ING3-inhibitor of growth family, member 3 Gene now

Add to cart