CALCB-calcitonin-related polypeptide beta Gene View larger

CALCB-calcitonin-related polypeptide beta Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CALCB-calcitonin-related polypeptide beta Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CALCB-calcitonin-related polypeptide beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008428
Product type: DNA & cDNA
Ncbi symbol: CALCB
Origin species: Human
Product name: CALCB-calcitonin-related polypeptide beta Gene
Size: 2ug
Accessions: BC008428
Gene id: 797
Gene description: calcitonin-related polypeptide beta
Synonyms: CALC2; CGRP-II; CGRP2; calcitonin gene-related peptide 2; beta-CGRP; beta-type CGRP; calcitonin 2; calcitonin gene-related peptide II; calcitonin related polypeptide beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtttccggaagttctcccccttcctggctctcagtatcttggtcctgtaccaggcgggcagcctccaggcggcgccattcaggtctgccctggagagcagcccagacccggccacactcagtaaagaggacgcgcgcctcctgctggctgcactggtgcaggactatgtgcagatgaaggccagtgagctgaagcaggagcaggagacacagggctccagctccgctgcccagaagagagcctgcaacactgccacctgtgtgactcatcggctggcaggcttgctgagcagatcagggggcatggtgaagagcaacttcgtgcccaccaatgtgggttccaaagcctttggcaggcgccgcagggaccttcaagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 28A
- natural killer cell group 7 sequence
- nuclear apoptosis inducing factor 1
- nucleoporin 62kDa C-terminal like

Buy CALCB-calcitonin-related polypeptide beta Gene now

Add to cart