Login to display prices
Login to display prices
CALCB-calcitonin-related polypeptide beta Gene View larger

CALCB-calcitonin-related polypeptide beta Gene

PTXBC008428

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CALCB-calcitonin-related polypeptide beta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CALCB-calcitonin-related polypeptide beta Gene

Proteogenix catalog: PTXBC008428
Ncbi symbol: CALCB
Product name: CALCB-calcitonin-related polypeptide beta Gene
Size: 2ug
Accessions: BC008428
Gene id: 797
Gene description: calcitonin-related polypeptide beta
Synonyms: CALC2; CGRP-II; CGRP2; calcitonin gene-related peptide 2; beta-CGRP; beta-type CGRP; calcitonin 2; calcitonin gene-related peptide II; calcitonin related polypeptide beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtttccggaagttctcccccttcctggctctcagtatcttggtcctgtaccaggcgggcagcctccaggcggcgccattcaggtctgccctggagagcagcccagacccggccacactcagtaaagaggacgcgcgcctcctgctggctgcactggtgcaggactatgtgcagatgaaggccagtgagctgaagcaggagcaggagacacagggctccagctccgctgcccagaagagagcctgcaacactgccacctgtgtgactcatcggctggcaggcttgctgagcagatcagggggcatggtgaagagcaacttcgtgcccaccaatgtgggttccaaagcctttggcaggcgccgcagggaccttcaagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: