NAIF1-nuclear apoptosis inducing factor 1 Gene View larger

NAIF1-nuclear apoptosis inducing factor 1 Gene

PTXBC021580

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NAIF1-nuclear apoptosis inducing factor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NAIF1-nuclear apoptosis inducing factor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021580
Product type: DNA & cDNA
Ncbi symbol: NAIF1
Origin species: Human
Product name: NAIF1-nuclear apoptosis inducing factor 1 Gene
Size: 2ug
Accessions: BC021580
Gene id: 203245
Gene description: nuclear apoptosis inducing factor 1
Synonyms: C9orf90; bA379C10.2; nuclear apoptosis-inducing factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgtcccagccaagaaaaggaagatgaacttctcagagcgggaggtggagatcatcgtggaggagctggagctgaagaagcacctgctggtgaaccacttcaacgccggggtacccctggccgccaagagtgcggcctggcacggcatcctgagaagggtcaacgccgtggccacctgccgcagagagctgcctgaggtcaagaagaagtggtctgacctcaagaccgaggtccgtcgcaaggttgcccaggtccgggccgccgtggagggtggtgaggcgccggggcccactgaggaggacggagctggggggcctgggacaggcggtggcagtggcggcggtggcccagctgtagccccagtgctgctgacccccatgcaacaacgtatctgcaacctgctgggcgaggccaccatcatcagcctgcccagcaccacagagatccaccctgtggccctcggaccctcggccaccgcagccgcagccacggtcaccctgacacagagtgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nucleoporin 62kDa C-terminal like
- isochorismatase domain containing 2
- phosphatidylcholine transfer protein
- regulator of G-protein signaling 20

Buy NAIF1-nuclear apoptosis inducing factor 1 Gene now

Add to cart