Cart 19 Product Products 4 159,10 € (empty)
-
-
-
-
-
-
-
-
-
1 x ZNF718-zin...121,50 € -
-
-
-
1 x NAIF1-nucl...113,40 € -
-
-
1 x EBI3-Epste...113,40 € -
1 x CCDC102B-c...113,40 € -
-
1 x RCVRN-reco...113,40 €
No products
To be determined Shipping
4 159,10 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 19 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 159,10 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 159,10 €
Data sheet of RGS20-regulator of G-protein signaling 20 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RGS20-regulator of G-protein signaling 20 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015614 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RGS20 |
| Origin species: | Human |
| Product name: | RGS20-regulator of G-protein signaling 20 Gene |
| Size: | 2ug |
| Accessions: | BC015614 |
| Gene id: | 8601 |
| Gene description: | regulator of G-protein signaling 20 |
| Synonyms: | ZGAP1; g(z)GAP; gz-GAP; regulator of G-protein signaling 20; gz-selective GTPase-activating protein; regulator of G-protein signaling 20 variant 2; regulator of G-protein signaling Z1; regulator of G-protein signalling 20; regulator of Gz-selective protein signaling 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggatcagagcggatggagatgcggaagcggcagatgcccgccgcccaggacacaccaggcgccgccccaggccagcccggagcggggagtcgcgggtccaacgcatgctgcttctgctggtgctgctgttgtagctgctcgtgtctcactgttagaaaccaggaagatcagaggcccacaatagcttcccacgaactcagagcagatcttccaacctgggaagaaagccctgctcctactctggaagaagtcaacgcctgggctcagtcatttgacaaattaatggtcactccagcaggaaggaatgcattccgtgaattcctccgaacagaattcagtgaggaaaatatgctcttctggatggcctgtgaggaactgaaaaaggaagctaataaaaacattattgaagagaaagcaaggataatctatgaagactacatttctatactttctcctaaggaggtgagcttagactcccgggtgagagaagtgatcaacagaaacatggtggagccatcccaacacatattcgatgatgctcaacttcagatttacaccctgatgcacagagactcatatcctcgattcatgaactctgctgtctataaggacttgcttcagtccttatcggagaaatctattgaagcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Nedd4 family interacting protein 2 - nipsnap homolog 3A (C. elegans) - inhibitor of growth family, member 4 - abhydrolase domain containing 14A |