ING4-inhibitor of growth family, member 4 Gene View larger

ING4-inhibitor of growth family, member 4 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ING4-inhibitor of growth family, member 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ING4-inhibitor of growth family, member 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007781
Product type: DNA & cDNA
Ncbi symbol: ING4
Origin species: Human
Product name: ING4-inhibitor of growth family, member 4 Gene
Size: 2ug
Accessions: BC007781
Gene id: 51147
Gene description: inhibitor of growth family, member 4
Synonyms: my036; p29ING4; inhibitor of growth protein 4; brain my036 protein; candidate tumor suppressor p33 ING1 homolog; inhibitor of growth family member 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcggggatgtatttggaacattatctggacagtattgaaaaccttccctttgaattacagagaaactttcagctcatgagggacctagaccaaagaacagaggacctgaaggctgaaattgacaagttggccactgagtatatgagtagtgcccgcagcctgagctccgaggaaaaattggcccttctcaaacagatccaggaagcctatggcaagtgcaaggaatttggtgacgacaaggtgcagcttgccatgcagacctatgagatggtggacaaacacattcggcggctggacacagacctggcccgttttgaggctgatctcaaggagaaacagattgagtcaagtgactatgacagctcttccagcaaaggcaaaaagaaaggccggactcaaaaggagaagaaagctgctcgtgctcgttccaaagggaaaaactcggatgaagaagcccccaagactgcccagaagaagttaaagctcgtgcgcacaagtcctgagtatgggatgccctcagtgacctttggcagtgtccacccctctgatgtgttggatatgcctgtggatcccaacgaacccacctattgcctttgtcaccaggtctcctatggagagatgattggctgtgacaaccctgattgttccattgagtggttccattttgcctgtgtggggctgacaaccaagcctcgggggaaatggttttgcccacgctgctcccaagaacggaagaagaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - abhydrolase domain containing 14A
- SH3-binding domain protein 5-like
- coiled-coil domain containing 151
- NEDD8 activating enzyme E1 subunit 1

Buy ING4-inhibitor of growth family, member 4 Gene now

Add to cart