Login to display prices
Login to display prices
ABHD14A-abhydrolase domain containing 14A Gene View larger

ABHD14A-abhydrolase domain containing 14A Gene

PTXBC002571

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ABHD14A-abhydrolase domain containing 14A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ABHD14A-abhydrolase domain containing 14A Gene

Proteogenix catalog: PTXBC002571
Ncbi symbol: ABHD14A
Product name: ABHD14A-abhydrolase domain containing 14A Gene
Size: 2ug
Accessions: BC002571
Gene id: 25864
Gene description: abhydrolase domain containing 14A
Synonyms: protein ABHD14A; DORZ1; abhydrolase domain-containing protein 14A; alpha/beta hydrolase domain-containing protein 14A; abhydrolase domain containing 14A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcggggcgctgtgcggctgctggttccgcctgggcggggcccgcccgctcatcccgttgggcccgactgtggtacagacctccatgagccagtcccaggtagccctgctgggcctgagtctgctgctcatgctcctactgtatgtggggctgccaggcccccctgagcagacttcctgcctctggggagaccccaatgtcacagtcctggctggtctcacccctggcaactcgcccatcttttaccgcgaggtgctcccactcaaccaggcacacagggtggaggtggtgctgcttcatggaaaggcctttaactctcacacgtgggagcagctgggcacactgcagctactgtcacagaggggctaccgggccgtggcccttgaccttccaggttttgggaactcggcaccttcaaaggaggcaagcacagaggcagggcgggcagcgctgctggagcgggcgctgcgggacctggaggtacagaatgccgtgttggtgagcccctcgctgagtggccactatgccctgcccttcctgatgcgaggccaccaccagctacatggatttgtgcccatcgcacccacctccacccagaactacacccaggagcaattctgggctgtgaagactccaacccttatcctgtatggagagctggaccacatcctggctcgagagtcactgcggcagctccgccacctgcccaaccactctgtggtgaagctacgcaatgcaggccatgcctgttacctccacaagccgcaagacttccaccttgtcctgcttgccttccttgaccatctaccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: