Login to display prices
Login to display prices
NAE1-NEDD8 activating enzyme E1 subunit 1 Gene View larger

NAE1-NEDD8 activating enzyme E1 subunit 1 Gene

PTXBC000480

New product

Data sheet of NAE1-NEDD8 activating enzyme E1 subunit 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NAE1-NEDD8 activating enzyme E1 subunit 1 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC000480
Ncbi symbol: NAE1
Product name: NAE1-NEDD8 activating enzyme E1 subunit 1 Gene
Size: 2ug
Accessions: BC000480
Gene id: 8883
Gene description: NEDD8 activating enzyme E1 subunit 1
Synonyms: A-116A10.1; APPBP1; HPP1; ula-1; NEDD8-activating enzyme E1 regulatory subunit; APP-BP1; NEDD8-activating enzyme E1 subunit; amyloid beta precursor protein binding protein 1, 59kDa; amyloid beta precursor protein-binding protein 1, 59 kDa; amyloid beta precursor protein-binding protein 1, 59kD; amyloid protein-binding protein 1; proto-oncogene protein 1; protooncogene protein 1; NEDD8 activating enzyme E1 subunit 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcagctgggaaagctgctcaaggagcagaagtacgaccggcagctgaggttgtggggtgatcatgggcaagaggctttagaatctgctcatgtttgcctaataaatgcaacagccacaggaactgaaattcttaaaaacttggtactaccaggtattggttcgtttacaattattgatggaaatcaggtcagcggagaagatgctggaaacaatttcttccttcaaagaagcagtatcggcaagaaccgagctgaagctgccatggaattcttacaagaattaaatagcgatgtctctggaagttttgtggaagagagtccagaaaaccttctagacaatgatccctcatttttctgtaggtttactgttgtagttgcaactcagcttcctgaaagcacttcactacgcttagcagatgtcctctggaattcccagattcctcttttgatctgtaggacatatggactagttggttatatgaggatcattataaaagaacatccagtaatagaatctcatccagataatgcattagaggatctacgactagataagccatttcctgaactgagagaacattttcagtcctatgatttggatcatatggaaaaaaaggaccacagtcatactccatggattgtgatcatagctaaatatttagcacagtggtatagtgaaacaaatggacgaatacctaaaacgtataaagaaaaagaggacttcagagatttgattagacaaggaattctaaaaaatgaaaatggggctccagaagatgaagagaattttgaagaagctattaaaaatgtgaacacagcactaaatacaactcagatcccaagcagtattgaagatatatttaatgatgatcgctgcataaatatcaccaaacagactccatcattttggattttagctcgtgccttaaaggaatttgtggccaaagagggtcaaggaaatttacctgttcgaggcacaattcctgatatgattgcagattcaggcaaatatataaaactgcaaaacgtttaccgtgaaaaagcaaagaaagatgctgccgctgtgggtaatcatgttgccaaattgctgcagtccattggccaggcaccagagtccatttcagagaaagaattaaaattactctgcagcaattctgcatttcttcgagtggtaagatgtcgatccttagctgaagaatatggtttggatacaattaacaaggatgaaattatttctagcatggacaatccagataatgaaatagtgttgtacttaatgttacgggctgttgatagatttcataaacaacagggtagatatccaggagtatctaactatcaagttgaagaagatataggaaagttgaagtcttgtctcactggcttccttcaggaatatggtttatctgtaatggtgaaagatgattatgtccacgaattttgccgatatggagctgctgagccacataccattgctgcattcttggggggagctgctgctcaagaggtcatcaaaataatcaccaaacaatttgtaatttttaataatacttacatttacagtggcatgtcacaaacttcagcaactttccagttgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: