SH3BP5L-SH3-binding domain protein 5-like Gene View larger

SH3BP5L-SH3-binding domain protein 5-like Gene

PTXBC017254

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SH3BP5L-SH3-binding domain protein 5-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SH3BP5L-SH3-binding domain protein 5-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017254
Product type: DNA & cDNA
Ncbi symbol: SH3BP5L
Origin species: Human
Product name: SH3BP5L-SH3-binding domain protein 5-like Gene
Size: 2ug
Accessions: BC017254
Gene id: 80851
Gene description: SH3-binding domain protein 5-like
Synonyms: SH3 domain-binding protein 5-like; SH3BP-5-like; SH3 binding domain protein 5 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgagctcagacaggttccaggagggcgggagaccccacagggggagctgcggcctgaagttgtagaggatgaagtccctaggagcccagtcgcagaagagcctggaggaggtggaagcagcagcagtgaggccaaattgtccccaagagaggaggaagaactggatcctagaatacaggaggagttggagcacctgaaccaggccagcgaggagatcaaccaggtggaactacagctggatgaggccaggaccacctatcggaggatcctacaggagtcggcgaggaaactgaatacacagggttcccacttggggagctgcatcgagaaagcccggccctactatgaggctcggcggctggctaaggaggctcagcaggagacacagaaggcagcgctgcggtacgagcgggccgtaagcatgcacaacgctgctcgagaaatggtgtttgtggctgagcagggcgtcatggctgacaagaaccgactggaccccacgtggcaggagatgctgaaccatgctacctgcaaggtgaatgaggcggaggaagagcggcttcgaggtgagcgggagcaccagcgagtgactcggctgtgccaacaggctgaggctcgggtccaagccctgcagaagaccctccggagggccatcggcaagagccgcccctactttgagctcaaggcccagttcagccagatcctggaggagcacaaggccaaggtgacagaactggagcagcaggtagctcaggccaagacgcgctactccgtggcccttcgtaacctggagcagatcagcgagcagattcacgcacggcgccgcgggggtctgcctccccaccccctgggccctcggcgctcctcccccgtgggggccgaggcaggacccgaggacatggaggacggagacagcgggattgagggggccgagggtgcggggctggaggagggcagcagcctggggcccggccccgcccccgacaccgataccctgagtctgctgagcctgcgcacggtggcttcagacctgcagaagtgcgactccgtggagcacttgcgaggcctctcggaccacgtcagtctggacggccaagagctgggaacgcggagtggagggcgccggggcagcgacggcggagcccgtgggggtcggcaccagcgcagcgtcagcctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 151
- NEDD8 activating enzyme E1 subunit 1
- coiled-coil domain containing 120
- inter-alpha (globulin) inhibitor H5

Buy SH3BP5L-SH3-binding domain protein 5-like Gene now

Add to cart