NDFIP2-Nedd4 family interacting protein 2 Gene View larger

NDFIP2-Nedd4 family interacting protein 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDFIP2-Nedd4 family interacting protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NDFIP2-Nedd4 family interacting protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021988
Product type: DNA & cDNA
Ncbi symbol: NDFIP2
Origin species: Human
Product name: NDFIP2-Nedd4 family interacting protein 2 Gene
Size: 2ug
Accessions: BC021988
Gene id: 54602
Gene description: Nedd4 family interacting protein 2
Synonyms: N4WBP5A; NEDD4 family-interacting protein 2; MAPK-activating protein PM04 PM05 PM06 PM07; NEDD4 WW domain-binding protein 5A; NF-kappa-B-activating protein 413; Nedd4 family interacting protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcaccaccagccggggactgggcgctaccaggtgcttcttaatgaagaggataactcagaatcatcggctatagagcagccacctacttcaaacccagcaccgcagattgtgcaggctgcgtcttcagcaccagcacttgaaactgactcttcccctccaccatatagtagtattactgtggaagtacctacaacttcagatacagaagtttacggtgagttttatcccgtgccacctccctatagcgttgctacctctcttcctacatacgatgaagctgagaaggctaaagctgctgcaatggcagctgcagcagcagaaacatctcaaagaattcaggaggaagagtgtccaccaagagatgacttcagtgatgcagaccagctcagagtggggaatgatggcattttcatgctggcatttttcatggcatttattttcaactggcttggattttgtttatccttctgtatcaccaataccatagctggaaggtatggtgctatctgcggatttggcctttccttgatcaaatggatccttattgtcaggttttctgattattttactggatatttcaatggacagtattggctttggtggatatttcttgtacttggcctgctccttttcttcagaggatttgttaattatctaaaagtcagaaacatgtctgaaagtatggcagctgctcatagaacaaggtatttcttcttattgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nipsnap homolog 3A (C. elegans)
- inhibitor of growth family, member 4
- abhydrolase domain containing 14A
- SH3-binding domain protein 5-like

Buy NDFIP2-Nedd4 family interacting protein 2 Gene now

Add to cart