PCTP-phosphatidylcholine transfer protein Gene View larger

PCTP-phosphatidylcholine transfer protein Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCTP-phosphatidylcholine transfer protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PCTP-phosphatidylcholine transfer protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012084
Product type: DNA & cDNA
Ncbi symbol: PCTP
Origin species: Human
Product name: PCTP-phosphatidylcholine transfer protein Gene
Size: 2ug
Accessions: BC012084
Gene id: 58488
Gene description: phosphatidylcholine transfer protein
Synonyms: PC-TP; STARD2; phosphatidylcholine transfer protein; START domain-containing protein 2; StAR-related lipid transfer (START) domain containing 2; stAR-related lipid transfer protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctggccgccggaagcttctcggaggagcagttctgggaggcctgcgccgagctccagcagcccgctctggccggggccgactggcagctcctagtggagacctcgggcatcagcatctaccggctgctggacaagaagactggactttatgagtataaagtctttggtgttctggaggactgctcaccaactctactggcagacatctatatggactcagattacagaaaacaatgggaccagtatgttaaagaactctatgaacaagaatgcaacggagagactgtggtctactgggaagtgaagtacccttttcccatgtccaacagagactatgtctaccttcggcagcggcgagacctggacatggaagggaggaagatccatgtgatcctggcccggagcacctccatgcctcagcttggcgagaggtctggggtgatccgggtgaagcaatacaagcagagcctggcgattgagagtgacggcaagaaggggagcaaagttttcatgtattacttcgataacccgggtggccaaattccgtcctggctcattaactgggccgccaagaatggagttcctaacttcttgaaagacatggcaagagcctgtcagaactacctcaagaaaacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - regulator of G-protein signaling 20
- Nedd4 family interacting protein 2
- nipsnap homolog 3A (C. elegans)
- inhibitor of growth family, member 4

Buy PCTP-phosphatidylcholine transfer protein Gene now

Add to cart