Login to display prices
Login to display prices
ANKRD26L1-ankyrin repeat domain 26-like 1 Gene View larger

ANKRD26L1-ankyrin repeat domain 26-like 1 Gene

PTXBC007072

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANKRD26L1-ankyrin repeat domain 26-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ANKRD26L1-ankyrin repeat domain 26-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007072
Product type: DNA & cDNA
Ncbi symbol: ANKRD26L1
Origin species: Human
Product name: ANKRD26L1-ankyrin repeat domain 26-like 1 Gene
Size: 2ug
Accessions: BC007072
Gene id: 84832
Gene description: ankyrin repeat domain 26-like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaacaagaactctgcagtttgagatttctgatagtcatgaaaaagaagaagacctgttgcataaaaaccatttgatgcaagatgaaattgccaggctcaggctggaaatacacacaataaaaaatcaaatcctggaaaagaaatacttaaaagacattgaaattataaaaagaaagcatgaagaccttcaaaaggctctaaaacagaatggggaaaaatcaacaaaaacgatagcccattatagtggacagcttactgctctgacagatgagaacacaatgctccgttctaaactggagaaggaaaaacaaagcaggcaaagactgacgaaatggaatcataccatcgtagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calcitonin-related polypeptide beta
- coiled-coil domain containing 28A
- natural killer cell group 7 sequence
- nuclear apoptosis inducing factor 1