BANF1-barrier to autointegration factor 1 Gene View larger

BANF1-barrier to autointegration factor 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BANF1-barrier to autointegration factor 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BANF1-barrier to autointegration factor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005942
Product type: DNA & cDNA
Ncbi symbol: BANF1
Origin species: Human
Product name: BANF1-barrier to autointegration factor 1 Gene
Size: 2ug
Accessions: BC005942
Gene id: 8815
Gene description: barrier to autointegration factor 1
Synonyms: BAF; BCRP1; D14S1460; NGPS; barrier-to-autointegration factor; breakpoint cluster region protein 1; barrier to autointegration factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaacctcccaaaagcaccgagacttcgtggcagagcccatgggggagaagccagtggggagcctggctgggattggtgaagtcctgggcaagaagctggaggaaaggggttttgacaaggcctatgttgtccttggccagtttctggtgctaaagaaagatgaagacctcttccgggaatggctgaaagacacttgtggcgccaacgccaagcagtcccgggactgcttcggatgccttcgagagtggtgcgacgccttcttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - inhibitor of growth family, member 3
- ankyrin repeat domain 26-like 1
- calcitonin-related polypeptide beta
- coiled-coil domain containing 28A

Buy BANF1-barrier to autointegration factor 1 Gene now

Add to cart