Login to display prices
Login to display prices
SH3BGRL-SH3 domain binding glutamic acid-rich protein like Gene View larger

SH3BGRL-SH3 domain binding glutamic acid-rich protein like Gene

PTXBC016709

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SH3BGRL-SH3 domain binding glutamic acid-rich protein like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SH3BGRL-SH3 domain binding glutamic acid-rich protein like Gene

Proteogenix catalog: PTXBC016709
Ncbi symbol: SH3BGRL
Product name: SH3BGRL-SH3 domain binding glutamic acid-rich protein like Gene
Size: 2ug
Accessions: BC016709
Gene id: 6451
Gene description: SH3 domain binding glutamic acid-rich protein like
Synonyms: HEL-S-115; SH3BGR; SH3 domain-binding glutamic acid-rich-like protein; SH3 domain binding glutamic acid-rich protein like; SH3-binding domain glutamic acid-rich protein like; epididymis secretory protein Li 115; SH3 domain binding glutamate rich protein like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgatccgtgtatatattgcatcttcctctggctctacagcgattaagaagaaacaacaagatgtgcttggtttcctagaagccaacaaaataggatttgaagaaaaagatattgcagccaatgaagagaatcggaagtggatgagagaaaatgtacctgaaaatagtcgaccagccacaggttaccccctgccacctcagattttcaatgaaagccagtatcgcggggactatgatgccttctttgaagccagagaaaataatgcagtgtatgccttcttaggcttgacagccccacctggttcaaaggaagcagaagtgcaagcaaagcagcaagcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: