SH3BGRL-SH3 domain binding glutamic acid-rich protein like Gene View larger

SH3BGRL-SH3 domain binding glutamic acid-rich protein like Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SH3BGRL-SH3 domain binding glutamic acid-rich protein like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SH3BGRL-SH3 domain binding glutamic acid-rich protein like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016709
Product type: DNA & cDNA
Ncbi symbol: SH3BGRL
Origin species: Human
Product name: SH3BGRL-SH3 domain binding glutamic acid-rich protein like Gene
Size: 2ug
Accessions: BC016709
Gene id: 6451
Gene description: SH3 domain binding glutamic acid-rich protein like
Synonyms: HEL-S-115; SH3BGR; SH3 domain-binding glutamic acid-rich-like protein; SH3 domain binding glutamic acid-rich protein like; SH3-binding domain glutamic acid-rich protein like; epididymis secretory protein Li 115; SH3 domain binding glutamate rich protein like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgatccgtgtatatattgcatcttcctctggctctacagcgattaagaagaaacaacaagatgtgcttggtttcctagaagccaacaaaataggatttgaagaaaaagatattgcagccaatgaagagaatcggaagtggatgagagaaaatgtacctgaaaatagtcgaccagccacaggttaccccctgccacctcagattttcaatgaaagccagtatcgcggggactatgatgccttctttgaagccagagaaaataatgcagtgtatgccttcttaggcttgacagccccacctggttcaaaggaagcagaagtgcaagcaaagcagcaagcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ChaC, cation transport regulator homolog 2 (E. coli)
- cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
- N-acylsphingosine amidohydrolase (acid ceramidase) 1
- guanine nucleotide binding protein-like 3 (nucleolar)

Buy SH3BGRL-SH3 domain binding glutamic acid-rich protein like Gene now

Add to cart