CHAC2-ChaC, cation transport regulator homolog 2 (E. coli) Gene View larger

CHAC2-ChaC, cation transport regulator homolog 2 (E. coli) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHAC2-ChaC, cation transport regulator homolog 2 (E. coli) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHAC2-ChaC, cation transport regulator homolog 2 (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019239
Product type: DNA & cDNA
Ncbi symbol: CHAC2
Origin species: Human
Product name: CHAC2-ChaC, cation transport regulator homolog 2 (E. coli) Gene
Size: 2ug
Accessions: BC019239
Gene id: 494143
Gene description: ChaC, cation transport regulator homolog 2 (E. coli)
Synonyms: ChaC, cation transport regulator-like 2; cation transport regulator-like protein 2; gamma-GCG 2; gamma-GCT acting on glutathione homolog 2; ChaC cation transport regulator homolog 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggtttttggttacgggtccctgatctggaaggtggatttcccctatcaggacaagctggtcggatacatcaccaactacagcaggcgcttctggcagggcagcacggaccaccgcggggtccccggcaagcctggaagagttgtgactcttgttgaagatcctgcgggatgtgtatggggtgttgcttacagattgccagtaggaaaggaagaagaagtaaaagcataccttgacttcagagaaaaaggaggctacagaaccacaacagtcattttttatccaaaagatcccacaacaaaaccattcagtgtattgctatatattggaacatgtgataatcctgattatcttggtcctgcacctctggaagacattgctgaacaaatttttaatgcagctggtccaagtggaagaaatacagaatatctttttgaacttgcaaattctattaggaaccttgtgccagaagaagcagatgagcatcttttcgctttggaaaaattagtaaaggaacgtttagaagggaaacagaacctcaattgcatataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
- N-acylsphingosine amidohydrolase (acid ceramidase) 1
- guanine nucleotide binding protein-like 3 (nucleolar)
- ATP-binding cassette, sub-family F (GCN20), member 2

Buy CHAC2-ChaC, cation transport regulator homolog 2 (E. coli) Gene now

Add to cart