Login to display prices
Login to display prices
CMPK1-cytidine monophosphate (UMP-CMP) kinase 1, cytosolic Gene View larger

CMPK1-cytidine monophosphate (UMP-CMP) kinase 1, cytosolic Gene

PTXBC014961

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CMPK1-cytidine monophosphate (UMP-CMP) kinase 1, cytosolic Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CMPK1-cytidine monophosphate (UMP-CMP) kinase 1, cytosolic Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014961
Product type: DNA & cDNA
Ncbi symbol: CMPK1
Origin species: Human
Product name: CMPK1-cytidine monophosphate (UMP-CMP) kinase 1, cytosolic Gene
Size: 2ug
Accessions: BC014961
Gene id: 51727
Gene description: cytidine monophosphate (UMP-CMP) kinase 1, cytosolic
Synonyms: CMK; CMPK; UMK; UMP-CMPK; UMPK; UMP-CMP kinase; UMP/CMP kinase; cytidine monophosphate (UMP-CMP) kinase 1, cytosolic; cytidylate kinase; dCMP kinase; deoxycytidylate kinase; nucleoside-diphosphate kinase; uridine monophosphate kinase; uridine monophosphate/cytidine monophosphate kinase; cytidine/uridine monophosphate kinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgagccgctgccgcagccggctgctccacgtcctgggccttagcttcctgctgcagacccgccggccgattctcctctgctctccacgtctcatgaagccgctggtcgtgttcgtcctcggcggccccggcgccggcaaggggacccagtgcgcccgcatcgtcgagaaatatggctacacacacctttctgcaggagagctgcttcgtgatgaaaggaagaacccagattcacagtatggtgaacttattgaaaagtacattaaagaaggaaagattgtaccagttgagataaccatcagtttattaaagagggaaatggatcagacaatggctgccaatgctcagaagaataaattcttgattgatgggtttccaagaaatcaagacaaccttcaaggatggaacaagaccatggatgggaaggcagatgtatctttcgttctcttttttgactgtaataatgagatttgtattgaacgatgtcttgagaggggaaagagtagtggtaggagtgatgacaacagagagagcttggaaaagagaattcagacctaccttcagtcaacaaagccaattattgacttatatgaagaaatggggaaagtcaagaaaatagatgcttctaaatctgttgatgaagtttttgatgaagttgtgcagatttttgacaaggaaggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-acylsphingosine amidohydrolase (acid ceramidase) 1
- guanine nucleotide binding protein-like 3 (nucleolar)
- ATP-binding cassette, sub-family F (GCN20), member 2
- ral guanine nucleotide dissociation stimulator-like 2