Login to display prices
Login to display prices
ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene View larger

ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene

PTXBC016828

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene

Proteogenix catalog: PTXBC016828
Ncbi symbol: ASAH1
Product name: ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene
Size: 2ug
Accessions: BC016828
Gene id: 427
Gene description: N-acylsphingosine amidohydrolase (acid ceramidase) 1
Synonyms: ACDase; ASAH; PHP; PHP32; SMAPME; acid ceramidase; N-acylsphingosine amidohydrolase (acid ceramidase) 1; acid CDase; acylsphingosine deacylase; N-acylsphingosine amidohydrolase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaactgctgcatcgggctgggagagaaggctcgcgggtcccaccgggcctcctacccaagtctcagcgcgcttttcaccgaggcctcaattctgggatttggcagctttgctgtgaaagcccaatggacagaggactgcagaaaatcaacctatcctccttcaggaccaactgtcttccctgctgttataaggtacagaggtgcagttccatggtacaccataaatcttgacttaccaccctacaaaagatggcatgaattgatgcttgacaaggcaccagtgcctggcctacttggcaactttcctggcccttttgaagaggaaatgaagggtattgccgctgttactgatatacctttaggagagattatttcattcaatattttttatgaattatttaccgtttgtacttcaatagtagcagaagacaaaaaaggtcatctaatacatgggagaaacatggattttggagtatttcttgggtggaacataaataatgatacctgggtcataactgagcaactaaaacctttaacagtgaatttggatttccaaagaaacaacaaaactgtcttcaaggcttcaagctttgctggctatgtgggcatgttaacaggattcaaaccaggactgttcagtcttacactgaatgaacgtttcagtataaatggtggttatctgggtattctagaatggattctgggaaagaaagatgccatgtggatagggttcctcactagaacagttctggaaaatagcacaagttatgaagaagccaagaatttattgaccaagaccaagatattggccccagcctactttatcctgggaggcaaccagtctggggaaggttgtgtgattacacgagacagaaaggaatcattggatgtatatgaactcgatgctaagcagggtagatggtatgtggtacaaacaaattatgaccgttggaaacatcccttcttccttgatgatcgcagaacgcctgcaaagatgtgtttgaaccgcaccagccaagagaatatctcatttgaaaccatgtatgatgtcctgtcaacaaaacctgtcctcaacaagctgaccgtatacacaaccttgatagatgttaccaaaggtcaattcgaaacttacctgcgggactgccctgacccttgtataggttggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: