Cart 2 Product Products 226,80 € (empty)
-
1 x C10orf97-c...113,40 € -
1 x PCID2-PCI...113,40 €
No products
To be determined Shipping
226,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 226,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 226,80 €
Data sheet of KRTAP19-5-keratin associated protein 19-5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KRTAP19-5-keratin associated protein 19-5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC100836 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KRTAP19-5 |
| Origin species: | Human |
| Product name: | KRTAP19-5-keratin associated protein 19-5 Gene |
| Size: | 2ug |
| Accessions: | BC100836 |
| Gene id: | 337972 |
| Gene description: | keratin associated protein 19-5 |
| Synonyms: | KAP19.5; keratin-associated protein 19-5; keratin associated protein 19-5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaactactacggcaactactatggaggcctgggctacggctacggaggcttcgatgacctgggctatggctatggctgtggatgtggcagcttccgcagactgggctatggcggtggctacggaggctacggatacggctctggcttcggaggctatggataccgcagctgccgtccatcatgctatggaggatatggattctctggattttattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - B melanoma antigen family, member 3 - keratin associated protein 12-2 - taste receptor, type 2, member 46 - keratin associated protein 10-1 |